₦airaland Forum

Welcome, Guest: RegisterLoginWith GoogleTrendingRecentNew

Stats: 3,326,184 members, 8,425,363 topics. Date: Friday, 12 June 2026 at 12:13 PM

Toggle theme

Atheism Is Foolishness? - Islam (5) - Nairaland

Nairaland ForumNairaland GeneralIslamAtheism Is Foolishness? (10897 Views)

1 2 3 4 5 6 7 Reply (Go Down)

Re: Atheism Is Foolishness? by tintingz(op):
usermane:
But how? No one has been able to demonstrate or abiogenesis. It's an hypothesis at best.
No one actually know the origin of life even religion, we only read fairytales from religions side. Abiogenesis theory tries to explain the origin of life with available observations and experiment. This make sense than fairytale in your book.

I really get your point here, I do. But at least theism promises the raped child divine compensation, atheism promises nothing. If you're wronged unjustly, so be it in atheism. This is not sensible to theists?
Divine compensation is a delusion, Karl Marx called it an opium, I call it a comfort zone.

This life is not perfect to begin with, life is not fair, why didn't God do something when the girl is being raped? Even after the wicked act God does not do anything, a rapist can get away with his action.

If you do something wrong, atheist will do something which is prosecuting the criminals. That's the best and real thing to do, Divine compensation is imaginary.

You should sit among theists and listen to their anecdotes. Listen to them recount how Allah heard their prayers and miraculously enriched them after years in poverty, or how Jesus healed their terminal cancer after months of fasting or how Yahweh continue to protect the Jewish state of Israel despite aggression from the surrounding enemy states.
This is a post hoc fallacy and a delusion grandeur.

There's no connection with healing and some imaginary entities, you're even confused since Jesus healed Christians and Allah healed Muslims and Vishnu healed Hindus and Zeus healed Hellenist and Ra healed the Egyptians which then is the true God here? Why aren't you a hindu praying to Vishnu instead of Allah?

To make your claims nonsensical, atheists don't even pray to any God and they are healed. China is an atheist state and they are developing, Nigeria is filled with religious people and she's moving backward daily.

Your claims are absurd.

To you I haven't said anything reasonable but I'm sure many theists reading this will agree with me, even though my concern is not necessarily to defend theism. The truth is that atheism, has it flaws as theism does. To some theists, atheism is just like a child abandoning his parents, it is not as rational or empowering as many atheists feel.
Atheists are not saying a first cause doesn't exist, there can be a cause of our existence we just don't know that, it can be the universe itself, or some aliens or forces we just don't know, there are thousands of gods claiming to be the creator, all these things don't have evidences or logical reason for their claims, so with honesty atheist like me simply say i don't know the origin of everything, there are no proves, i simply lack the belief of any God/s existence until they are proven.
Re: Atheism Is Foolishness? by Akin1212(m): 12:52am On Feb 04, 2019
usermane:
But how? No one has been able to demonstrate or abiogenesis. It's an hypothesis at best.
That's not true, please read about the Urey-Miller test. Abiogenesis is already being researched with lots of experiments and breakthroughs being found.

usermane:
I really get your point here, I do. But at least theism promises the raped child divine compensation, atheism promises nothing. If you're wronged unjustly, so be it in atheism. This is not sensible to theists?
But does this divinity have any proof or evidence of existence? It's evil to let people believe it's okay to suffer here on earth because they will enjoy in the hereafter when there's no single evidence of the hereafter. Empty promises are worst than no promises. Atheism won't deceive you, theism does.

usermane:
You should sit among theists and listen to their anecdotes. Listen to them recount how Allah heard their prayers and miraculously enriched them after years in poverty, or how Jesus healed their terminal cancer after months of fasting or how Yahweh continue to protect the Jewish state of Israel despite aggression from the surrounding enemy states.
Lmao grin. Would I also need to listen to how Zeus answered prayers? Or how Sango killed the adversaries of his worshippers, or how the cow they worship in India gave one of his worshipers a job, or how Baal has been protecting his worshippers, or how I don't worship anything and I'm doing so well?

How life happens to anyone is not a proof that any deity exists. It's life bro, it happens no matter what you worship or what you don't worship.

Or do I also need to listen to how Allah has been neglecting those who worship him in Yemen to be bombed too? How Jesus could not save his worshippers from ikeja cantonment bombing in 2001, or how Sango could not even save our ancestors from being shipped as slaves overseas, or how Zeus has failed to eradicated cancer all these years.

When you learn that life happens no matter what, you'll get the picture.

usermane:
To you I haven't said anything reasonable but I'm sure many theists reading this will agree with me, even though my concern is not necessarily to defend theism. The truth is that atheism, has it flaws as theism does. To some theists, atheism is just like a child abandoning his parents, it is not as rational or empowering as many atheists feel.
Oh, don't judge yourself already bro, you tried but your flaws are very obvious. Atheism does not have any flaw. It is simply a disbelief in claims that cannot be substantiated with evidence. If there is no theism, there will not be atheism. Atheism is not like a child abandoning his parents, any theist who think that is basically stupid. Atheism is like a child growing up from the lies his parents told him. Grown people should act like grown people.
Re: Atheism Is Foolishness? by Nobody: 6:10am On Feb 04, 2019
Akin1212:
But does this divinity have any proof or evidence of existence? It's evil to let people believe it's okay to suffer here on earth because they will enjoy in the hereafter when there's no single evidence of the hereafter. Empty promises are worst than no promises. Atheism won't deceive you, theism does.
May I know the methods you used in concluding that there are no evidences? Or you just sat at one corner of your room and concluded that there are no evidences?
Re: Atheism Is Foolishness? by usermane(m): 8:35am On Feb 04, 2019
tintingz:
No one actually know the origin of life even religion, we only read fairytales from religions side. Abiogenesis theory tries to explain the origin of life with available observations and experiment. This make sense than fairytale in your book.
tingtingz, one man fairytale is another man's fact. Even though I'm not fully convinced by religions' account of origin of life, I will admit religion is still right in one aspect, life originated from a pre-existing life. This is the law of biology and by contradicting this law, abiogenesis becomes unconvincing for most folks until proven. In this case, even if we reject theism, Deism is far better option than atheism.

Divine compensation is a delusion, Karl Marx called it an opium, I call it a comfort zone.

This life is not perfect to begin with, life is not fair, why didn't God do something when the girl is being raped? Even after the wicked act God does not do anything, a rapist can get away with his action.

If you do something wrong, atheist will do something which is prosecuting the criminals. That's the best and real thing to do, Divine compensation is imaginary.
I've already addressed this. I admit you've raised an important objection, but it is not enough to convince certain theists. These theists also do have laws that penalizes crimes, but as I explained before, criminals escape the law all the time. Need I also add that in theism, God let evil happen for just reasons, which may or may not be comprehensive to man.

There is a limit to logic in theism, it gets to a point where emotion, insecurities, fears and confusion dominate to drive belief.

This is a post hoc fallacy and a delusion grandeur.

There's no connection with healing and some imaginary entities, you're even confused since Jesus healed Christians and Allah healed Muslims and Vishnu healed Hindus and Zeus healed Hellenist and Ra healed the Egyptians which then is the true God here? Why aren't you a hindu praying to Vishnu instead of Allah?

To make your claims nonsensical, atheists don't even pray to any God and they are healed. China is an atheist state and they are developing, Nigeria is filled with religious people and she's moving backward daily.
I've told you before, Zeus, Jesus, Vishnu, Ra, Allah - these are just names referring to the same entity, the same being. So, it is possible that
the same God still assist these people in need. As to why atheists experience similar miracles to theists even without praying or believing, I have no response. You have a point.

However, beliefs are heavily shaped by personal experiences. If a theist feel strongly that his prayers are working, there is really no motive for him to consider atheism.

Your claims are absurd.
Atheists are not saying a first cause doesn't exist, there can be a cause of our existence we just don't know that, it can be the universe itself, or some aliens or forces we just don't know, there are thousands of gods claiming to be the creator, all these things don't have evidences or logical reason for their claims, so with honesty atheist like me simply say i don't know the origin of everything, there are no proves, i simply lack the belief of any God/s existence until they are proven.
Fair enough.
Re: Atheism Is Foolishness? by usermane(m): 9:00am On Feb 04, 2019
Akin1212:
That's not true, please read about the Urey-Miller test. Abiogenesis is already being researched with lots of experiments and breakthroughs being found.
Ha?! There are breakthroughs, but there is still a long way to go, to be honest. Until the first bacteria DNA is synthesized, there isn't much to consider to be honest. I feel a better alternative to abiogenesis would be that extraterrestrials cooked up man and all earth life in a lab.

But does this divinity have any proof or evidence of existence? It's evil to let people believe it's okay to suffer here on earth because they will enjoy in the hereafter when there's no single evidence of the hereafter. Empty promises are worst than no promises. Atheism won't deceive you, theism does.
No objection on my part. But see, it's not just about me. It's about the billions of theists out there who believe that God has good reasons for letting suffering happen on earth to innocent people. Theists believe God is all wise, and He has good purpose for not stopping evil. Purposes that are best known to him.

Lmao grin. Would I also need to listen to how Zeus answered prayers? Or how Sango killed the adversaries of his worshippers, or how the cow they worship in India gave one of his worshipers a job, or how Baal has been protecting his worshippers, or how I don't worship anything and I'm doing so well?

How life happens to anyone is not a proof that any deity exists. It's life bro, it happens no matter what you worship or what you don't worship.

Or do I also need to listen to how Allah has been neglecting those who worship him in Yemen to be bombed too? How Jesus could not save his worshippers from ikeja cantonment bombing in 2001, or how Sango could not even save our ancestors from being shipped as slaves overseas, or how Zeus has failed to eradicated cancer all these years.

When you learn that life happens no matter what, you'll get the picture.
No objection on my part. But, like I explained to tinting, you cannot undermine the significance of personal experiences in individual beliefs. And as to evil happening to theists without divine intervention, please do remember that theists do regard these evils as divine punishment or trials from God. Theists believe that God sometimes punishes or test his followers with calamities and misfortunes.
Re: Atheism Is Foolishness? by tintingz(op):
usermane:
tingtingz, one man fairytale is another man's fact. Even though I'm not fully convinced by religions' account of origin of life, I will admit religion is still right in one aspect, life originated from a pre-existing life. This is the law of biology and by contradicting this law, abiogenesis becomes unconvincing for most folks until proven. In this case, even if we reject theism, Deism is far better option than atheism.
A fairytale will always be a fairytale, there's no fact in it. Hope you know what "fact" means? If someone believe a fairytale is fact such person is delusional. I can as well believe in Marvel comics and say they are facts.

And what pre-existing life did life originate from?

I've already addressed this. I admit you've raised an important objection, but it is not enough to convince certain theists. These theists also do have laws that penalizes crimes, but as I explained before, criminals escape the law all the time. Need I also add that in theism, God let evil happen for just reasons, which may or may not be comprehensive to man.
When someone start talking about things that are not real claiming to be true is delusional!

If God letting evil happen(which he hate) cannot be rationalize then God do thing for meaningless reasons.

There's no prove of divine compensation, we're alive and we need to work with what is real not imaginary and fairytales, humans are not perfect, life is not perfect, afterlife according to religions is meaningless. Religions are confused if there's a divine compensation and justice why bother penalizing criminals, why can't they wait for God to do something?

Religious people are mostly delusional, they don't know what's real and what's not.

There is a limit to logic in theism, it gets to a point where emotion, insecurities, fears and confusion dominate to drive belief.
This is like saying there's a point where theism is unreasonable.

I've told you before, Zeus, Jesus, Vishnu, Ra, Allah - these are just names referring to the same entity, the same being. So, it is possible that
the same God still assist these people in need. As to why atheists experience similar miracles to theists even without praying or believing, I have no response. You have a point.
I've told you before, a God is not define by name only, a God is define by his attributes, characters and mythology. The gods you mentioned are totally different from each other in many ways. Do you believe Allah has an eagle head? Because that's what Ra is.

So no they are not praying to same entities.

However, beliefs are heavily shaped by personal experiences. If a theist feel strongly that his prayers are working, there is really no motive for him to consider atheism.
Will the theist consider atheism if they get healed without praying?

Prayer doesn't do anything, it's just way to feel there's some fairy being listening you.

People get healed randomly, it has no connection with prayers, religious people just use their cognitive bias to satisfy their wishful thinking.
Re: Atheism Is Foolishness? by tintingz(op):
AbdelKabir:
May I know the methods you used in concluding that there are no evidences? Or you just sat at one corner of your room and concluded that there are no evidences?
Lol the burden of proof fallacy.

"Affirmati Non Neganti Incumbit Probatio" which means “the burden of proof is upon him who affirms - not on him who denies."

Even though there are no methods to prove negative, you can't prove negative, this is a general terms in logic and law. But I believe we can prove negative, since you're positive about your position then you have evidence, the burden of proof is on you, now present your evidence or methods to look into for the existence of your super-being let's scrutinize it.

If you're unable to provide any evidence then that solve the problem.

If I claim there's an invisible flying unicorn flying around the space, can you prove there's no invisible flying unicorn in the space?
Re: Atheism Is Foolishness? by Akin1212(m): 4:40pm On Feb 04, 2019
AbdelKabir:
May I know the methods you used in concluding that there are no evidences? Or you just sat at one corner of your room and concluded that there are no evidences?
Let's start by defining testable evidence: A testable evidence or proof is or are facts or observations that are presented in support of an assertion or claim.

Also evidence is a body of objectively and not subjectively verifiable facts that are positively indicative of, and/or exclusively concordant with, that one conclusion over another.

Culled from Wikitionary.


Now, let's stop blowing grammar, in lay terms, the evidence I am asking for is an objective evidence that can be seen or felt by everyone irrespective of what you believe, who you are, what you do, how you look, or what you eat, that is independent of having faith in that which evidence is asked for.

For example, if there is evidence for the existence of Allah, everyone should be able to verify these evidence and not just Muslims, and verifying these evidence will not require you to be a Muslim first or believe in Allah first.

If you have these type of testable and verifiable evidence, please drop them. Thanks.
Re: Atheism Is Foolishness? by Akin1212(m): 4:55pm On Feb 04, 2019
usermane:
Ha?! There are breakthroughs, but there is still a long way to go, to be honest. Until the first bacteria DNA is synthesized, there isn't much to consider to be honest. I feel a better alternative to abiogenesis would be that extraterrestrials cooked up man and all earth life in a lab.
If you don't do research but base your faith in old books that were written thousands of years ago, information will always elude you. There is still a long way to go, says who? Are you a researcher? The synthesis of life or a cell is history in the science world, stop deceiving yourself. The emergence of life or complex cell like a bacteria was not a single event, it takes time and special conditions, we don't need to synthesize a new bacteria from scratch for people like you to accept abiogenesis, that's not the aim, and because you want to see it happen does not mean it will be done, else you must also be ready to talk to your God to be ready to send down the manual he also used to create Adam and Eve down to earth too because we also need a plausible hypothetical mechanism of how he did it as you have claimed. The truth about science is that, it is true, whether you accept it or not. That extraterrestrials cooked up man is just another nonsense, prove it.

https://www.independent.co.uk/news/science/artificial-life-synthetic-dna-scientists-living-organisms-create-scripps-research-institute-floyd-a8083966.html

usermane:
No objection on my part. But see, it's not just about me. It's about the billions of theists out there who believe that God has good reasons for letting suffering happen on earth to innocent people. Theists believe God is all wise, and He has good purpose for not stopping evil. Purposes that are best known to him.
And that is why theism is a disease that eats deep into the skull of people right from childhood. Isn't that why they kill themselves for an unproven God? Because billions of people believe something doesn't make it right, does it?

usermane:
No objection on my part. But, like I explained to tinting, you cannot undermine the significance of personal experiences in individual beliefs. And as to evil happening to theists without divine intervention, please do remember that theists do regard these evils as divine punishment or trials from God. Theists believe that God sometimes punishes or test his followers with calamities and misfortunes.
If religion is restricted to individual beliefs then no one will be disturbed. But when it comes to where they will now say those who don't share the belief with them will suffer forever in hell is where we will have problem. Everyone should worship their own god and go to their own heaven or hell. But is that how it is? How come you now said religion is an individual thing?

Theists are basically stupid people, cognitive bias will not let them have peace. Can a loving and merciful God be a punisher? I don't need to overflog this particular issue. You can't be white and also be black at the same time.
Re: Atheism Is Foolishness? by usermane(m): 6:12pm On Feb 04, 2019
tintingz:
A fairytale will always be a fairytale, there's no fact in it. Hope you know what "fact" means? If someone believe a fairytale is fact such person is delusional. I can as well believe in Marvel comics and say they are facts.
No, Marvel comics itself claim to be fiction.

And what pre-existing life did life originate from?
God is the pre-existing life in case of theism.

If God letting evil happen(which he hate) cannot be rationalize then God do thing for meaningless reasons.
Meaningless? tingting, do you still remember the story of Job(Ayyuba), servant of God? The calamities that befell him, the purpose of those calamities and how God restored him?

There's no prove of divine compensation, we're alive and we need to work with what is real not imaginary and fairytales, humans are not perfect, life is not perfect, afterlife according to religions is meaningless. Religions are confused if there's a divine compensation and justice why bother penalizing criminals, why can't they wait for God to do something?
Fair enough.

Religious people are mostly delusional, they don't know what's real and what's not.

This is like saying there's a point where theism is unreasonable.
See, the thing is like this. In theism, there is a limit to rationalism. The human brain is incapable of understanding certain notions and blind faith or suspension of disbelief is the only way forward. Either this or it is apostasy. But apostasy is not always an option for every theist.

I've told you before, a God is not define by name only, a God is define by his attributes, characters and mythology. The gods you mentioned are totally different from each other in many ways. Do you believe Allah has an eagle head? Because that's what Ra is.

So no they are not praying to same entities.
You may as well be right, but you're neglecting the fact that two persons may bear alternate perception of the same thing. The perception of God, is irrelevant here. They are all referring to a creator and sustainer of heaven, earth and life.

Will the theist consider atheism if they get heal without praying?
May be, may be not. I really don't consider prayer 'working' to be genuine proof of God. But the real issue here is that theists wouldn't consider such a test because even if this were a good test, it would be too much risk for someone who strongly believes there exist a God listening to him.

Prayer doesn't do anything, it's just way to feel there's some fairy being listening you.
People get heal randomly, it has no connection with prayers, religious people just use their cognitive bias to for satisfy their wishful thinking.
Fair enough.
Re: Atheism Is Foolishness? by tintingz(op): 7:56pm On Feb 04, 2019
usermane:
No, Marvel comics itself claim to be fiction.
Marvel comics are honest while theists like Muslims are dishonest.

Independent historian has labeled the stories in the Quran as fiction, legends and mythology.

God is the pre-existing life in case of theism.
And they can't proof it.

Meaningless? tingting, do you still remember the story of Job(Ayyuba), servant of God? The calamities that befell him, the purpose of those calamities and how God restored him?
That story is ridiculous and nonsensical.

What purpose does God who's all-knowing wants to gain in testing job's life when he already knows the outcome of it. He already knows every action and decisions of job. This same nonsense also apply to Abraham commanded by God to slaughter his son.

God is doing what he hate and yet command these people to do what he hate. Doesn't make any sense!

Is God malevolent or confused?

See, the thing is like this. In theism, there is a limit to rationalism. The human brain is incapable of understanding certain notions and blind faith or suspension of disbelief is the only way forward. Either this or it is apostasy. But apostasy is not always an option for every theist.
If something cannot be rationalized then it doesn't make any sense and should be discarded.

Theism knows many of their beliefs doesn't make any sense but they still stick to it for some delusional reasons.

You may as well be right, but you're neglecting the fact that two persons may bear alternate perception of the same thing. The perception of God, is irrelevant here. They are all referring to a creator and sustainer of heaven, earth and life.
I totally disagree with all Gods are the same, if all Gods are the same then a Muslim should be able to walk to an Ifa shrine to pray or to Jews synagogue to pray or to Hindu temple to pray.

Instead we see religious conflicts everywhere.

May be, may be not. I really don't consider prayer 'working' to be genuine proof of God. But the real issue here is that theists wouldn't consider such a test because even if this were a good test, it would be too much risk for someone who strongly believes there exist a God listening to him.
This is bias from theist side.

The world is imperfect to think some imaginary master in the sky is answering people's prayer.
Re: Atheism Is Foolishness? by Nobody: 5:00am On Feb 05, 2019
Akin1212:
Let's start by defining testable evidence: A testable evidence or proof is or are facts or observations that are presented in support of an assertion or claim.

Also evidence is a body of objectively and not subjectively verifiable facts that are positively indicative of, and/or exclusively concordant with, that one conclusion over another.

Culled from Wikitionary.


Now, let's stop blowing grammar, in lay terms, the evidence I am asking for is an objective evidence that can be seen or felt by everyone irrespective of what you believe, who you are, what you do, how you look, or what you eat, that is independent of having faith in that which evidence is asked for.

For example, if there is evidence for the existence of Allah, everyone should be able to verify these evidence and not just Muslims, and verifying these evidence will not require you to be a Muslim first or believe in Allah first.

If you have these type of testable and verifiable evidence, please drop them. Thanks.
Good, the correct thing you should've said is "we don't have sufficient equipments to prove the metaphysical world" not "there is no proof" you saying there is no proof is simply a "belief" you are holding on to which you have no proof for, so you are falling into the exact thing you accuse theist of, that they have blind faith. I believe I'm clear enough....





As for the one that retorted with "you can't prove a negative", this is not a credible answer as in this answer you've already assumed that your claim to be true, so look for something else to say.
Re: Atheism Is Foolishness? by tintingz(op): 8:17am On Feb 05, 2019
AbdelKabir:
Good, the correct thing you should've said is "we don't have sufficient equipments to prove the metaphysical world" not "there is no proof" you saying there is no proof is simply a "belief" you are holding on to which you have no proof for, so you are falling into the exact thing you accuse theist of, that they have blind faith. I believe I'm clear enough....





As for the one that retorted with "you can't prove a negative", this is not a credible answer as in this answer you've already assumed that your claim to be true, so look for something else to say.
In logic and law you can't prove negative, you can't even prove negative of nature, but I believe we can you just have to present your methods to look into for your claims and let's scrutinize it.

Go back and re-read my premise.

A metaphysical world do you mean a spiritual world? This is negative of our natural world, you can't prove it, if you do then it's no longer a spiritual world as it seems.
Re: Atheism Is Foolishness? by Akin1212(m): 8:26am On Feb 05, 2019
AbdelKabir:
Good, the correct thing you should've said is "we don't have sufficient equipments to prove the metaphysical world" not "there is no proof" you saying there is no proof is simply a "belief" you are holding on to which you have no proof for, so you are falling into the exact thing you accuse theist of, that they have blind faith. I believe I'm clear enough....
You see, this is why it is advised not to prove a negative because it is a logical crime. If you presuppose that we don't have enough equipments to prove the metaphysical world, you are indirectly saying the metaphysical world exists. But the existence is what we are asking you to prove that you can't. And the existence that we can't prove is only an assumption not a fact. There is no proof of the metaphysical world, the only thing there is proof of is ignorance that leads to the assumption that there is a metaphysical world. When people see a process that they don't understand, as a result of ignorance, they attribute it to the metaphysical. A process that you can't explain is not a proof of the metaphysical world, it's just the proof that you don't know what you're observing.

Saying there is no proof is not a belief, are you confused on the definition of what a belief is? Saying there is no proof is a claim that there is no proof at all for something of which there is zero proof of. You are not clear enough at all as I can see that you have successfully confused yourself into believing that asking for evidence and saying there is no proof of the metaphysical is a belief. Lol, that's very laughable.
Re: Atheism Is Foolishness? by Nobody: 12:01pm On Feb 05, 2019
Look a them, they don't even understand what I'm saying......
Re: Atheism Is Foolishness? by tintingz(op): 12:21pm On Feb 05, 2019
AbdelKabir:
Look a them, they don't even understand what I'm saying......
What then are you saying? undecided
Re: Atheism Is Foolishness? by Akin1212(m): 1:43pm On Feb 05, 2019
AbdelKabir:
Look a them, they don't even understand what I'm saying......
Lol, that's because you're not saying anything.

If you can't explain it simple enough, then you're confused. Or perhaps you're saying exactly what we thought.
Re: Atheism Is Foolishness? by sino(m):
I often wonder how convenient it is for these supposed atheists to question evidences about God, when they themselves hold on to some sort of faith in their acceptance of scientific hypotheses/theories…

Let me bring an example to drive home my point. Our ‘biochemist’ atheist (Akin1212) wants us to believe that abiogenesis is true, he has bragged about the achievements and breakthroughs thus far and how true they are, but quick to acknowledge the difficulty cum unlikelihood of ‘creating’ life from scratch…

So what evidences did Mr. Scientist bring thus far?!

1. Urey-Miller Experiment
2. Synthetic DNA

It should first be noted that the first has a lot of baggage, one of which is the assumption of the early earth and what it contained, also it still couldn’t account for the complex molecules found in life, not to even mention that the amino acids produced were racemic, and what happened to these amino acids to become 'alive', amongst others…Of course, there are more assumptions to explain away all these baggage

Secondly, synthetic DNA only shows that there is a need for an intelligent designer, it took the researchers more than 2 decades, of studying, planning, strategizing and experimenting to come up with a synthetic base pair not to also mention the fact that this synthetic base pair cannot do zilch except it is incorporated into already existing DNA and life! Wow! But about 3 billion base pairs found in man are from a random occurrence right?! Oh sorry, it took billions of years of purposeless trial and error to produce the complexity and diversity of life abi?!

When faced with the obvious reality which would require them to provide observable and reproducible concrete evidences of ‘creating’ artificial life from nonliving materials, the atheist could only but retort, demanding for evidences of how God created man! Well, out goes the scientific method guys….And in comes the faith-based science “the truth about science is that, it is true, whether you accept it or not”

Here above, we have the supposed evidences that our scientifically inclined ‘scientist’ atheist uses to believe in abiogenesis as true! When we then tell them that their own existence including the universe and how they function are evidences enough to prove the existence of an intelligent, powerful, all knowing etc. creator called God; they go on a hyperventilating tirade, as if that changes anything!

Allah (SWT) Says:

Or were they created by nothing, or were they the creators [of themselves]?
Or did they create the heavens and the earth? Rather, they are not certain.


(Qur'an 52:34-35)

Are the atheists here foolish?! Your guess is as good as mine! grin grin grin
Re: Atheism Is Foolishness? by tintingz(op): 3:50pm On Feb 05, 2019
sino:
I often wonder how convenient it is for these supposed atheists to question evidences about God, when they themselves hold on to some sort of faith in their acceptance of scientific hypotheses/theories…

Let me bring an example to drive home my point. Our ‘biochemist’ atheist (Akin1212) wants us to believe that abiogenesis is true, he has bragged about the achievements and breakthroughs thus far and how true they are, but quick to acknowledge the difficulty cum unlikelihood of ‘creating’ life from scratch…

So what evidences did Mr. Scientist bring thus far?!

1. Urey-Miller Experiment
2. Synthetic DNA

It should first be noted that the first has a lot of baggage, one of which is the assumption of the early earth and what it contained, also it still couldn’t account for the complex molecules found in life, not to even mention that the amino acids produced were racemic, and what happened to these amino acids to become 'alive', amongst others…Of course, there are more assumptions to explain away all these baggage

Secondly, synthetic DNA only shows that there is a need for an intelligent designer, it took the researchers more than 2 decades, of studying, planning, strategizing and experimenting to come up with a synthetic base pair not to also mention the fact that this synthetic base pair cannot do zilch except it is incorporated into already existing DNA and life! Wow! But about 3 billion base pairs found in man are from a random occurrence right?! Oh sorry, it took billions of years of purposeless trial and error to produce the complexity and diversity of life abi?!

When faced with the obvious reality which would require them to provide observable and reproducible concrete evidences of ‘creating’ artificial life from nonliving materials, the atheist could only but retort, demanding for evidences of how God created man! Well, out goes the scientific method guys….And in comes the faith-based science “the truth about science is that, it is true, whether you accept it or not”

Here above, we have the supposed evidences that our scientifically inclined ‘scientist’ atheist uses to believe in abiogenesis as true! When we then tell them that their own existence including the universe and how they function are evidences enough to prove the existence of an intelligent, powerful, all knowing etc. creator called God; they go on a hyperventilating tirade, as if that changes anything!

Allah (SWT) Says:

Or were they created by nothing, or were they the creators [of themselves]?
Or did they create the heavens and the earth? Rather, they are not certain.


(Qur'an 52:34-35)

Are the atheists here foolish?! Your guess is as good as mine! grin grin grin
How did you come to the conclusion it's God Allah that created you? Any evidence?
Re: Atheism Is Foolishness? by Akin1212(m): 8:41pm On Feb 05, 2019
sino:
I often wonder how convenient it is for these supposed atheists to question evidences about God, when they themselves hold on to some sort of faith in their acceptance of scientific hypotheses/theories…
I am almost getting tired responding with the same thing to your mediocre mind. Once again there is no faith being exercised where there is objective evidence. Scientific theories don't need to be believed, they need to be understood!

sino:
Let me bring an example to drive home my point. Our ‘biochemist’ atheist (Akin1212) wants us to believe that abiogenesis is true, he has bragged about the achievements and breakthroughs thus far and how true they are, but quick to acknowledge the difficulty cum unlikelihood of ‘creating’ life from scratch…

So what evidences did Mr. Scientist bring thus far?!

1. Urey-Miller Experiment
2. Synthetic DNA
Ad hominem. Why attribute it to me? Did I ever say I want you to 'believe' anything? If yes, could you please point to where I said that? I have only told you that Abiogenesis is the scientific theory based on series of experiments that have hard facts. Do you even need to believe anything, or are you cursed to believe everything?

In the course of running abiogenesis down your weak mind, I explained many scientific facts and truths, such as what all living things are made up of etc. It's not my fault that you cannot comprehend, Mr.

sino:
It should first be noted that the first has a lot of baggage, one of which is the assumption of the early earth and what it contained, also it still couldn’t account for the complex molecules found in life, not to even mention that the amino acids produced were racemic, and what happened to these amino acids to become 'alive', amongst others…Of course, there are more assumptions to explain away all these baggage
Lol, when you see ignorance, you know it. Are you trying to deceive the lay people by using the word 'alive' as regarding amino acids? I won't even respond to that hysterical baloney. The conditions of the early earth were not assumed. Read more bro

sino:
Secondly, synthetic DNA only shows that there is a need for an intelligent designer, it took the researchers more than 2 decades, of studying, planning, strategizing and experimenting to come up with a synthetic base pair not to also mention the fact that this synthetic base pair cannot do zilch except it is incorporated into already existing DNA and life! Wow! But about 3 billion base pairs found in man are from a random occurrence right?! Oh sorry, it took billions of years of purposeless trial and error to produce the complexity and diversity of life abi?!
Presuppositions again, a design only needs a designer, perhaps a DNA need a DNAer? cheesy

The first failure of logic here is to call a DNA a design, throw that babble out the window, please. When you're ready to discuss about the things you have zero knowledge about, we'll discuss it.
You obviously think man is the only living thing on earth. Lol, perhaps you're driven by the egoistic, vaguely purposeful life you're living to think of man alone as the center of all living things? Lwkmd. Wake up bro, it's not about typing grammar and epistles.

sino:
When faced with the obvious reality which would require them to provide observable and reproducible concrete evidences of ‘creating’ artificial life from nonliving materials, the atheist could only but retort, demanding for evidences of how God created man! Well, out goes the scientific method guys….And in comes the faith-based science “the truth about science is that, it is true, whether you accept it or not”
Artificial life is history. I knew you know nothing than to come here and make noise.

https://www.telegraph.co.uk/news/science/7745868/Scientist-Craig-Venter-creates-life-for-first-time-in-laboratory-sparking-debate-about-playing-god.html

You don't even understand how reactions work, talk more of the formation of nucleic acids. You think it takes place in one day? The formation of nucleic acids still take place inside humans and all living things including plants, but only this time it uses enzymes which make the reactions faster. I can't be teaching you biochemistry na, your ignorance is clearly written on the wall. Only if you approach your bold claims of your god existing this way lol. Science does not need to create a life for you to accept the truth, they only need to show processes with concrete evidence. Which have been shown already. But because you're still carrying about your childhood fears and fantasy, your mind is not open enough to accept the facts presented before you. However, how many concrete evidence have you provided for the existence of this your creator?

sino:
Here above, we have the supposed evidences that our scientifically inclined ‘scientist’ atheist uses to believe in abiogenesis as true! When we then tell them that their own existence including the universe and how they function are evidences enough to prove the existence of an intelligent, powerful, all knowing etc. creator called God; they go on a hyperventilating tirade, as if that changes anything

Allah (SWT) Says:

Or were they created by nothing, or were they the creators [of themselves]?
Or did they create the heavens and the earth? Rather, they are not certain.


(Qur'an 52:34-35)

Are the atheists here foolish?! Your guess is as good as mine! grin grin grin
Lol, as usual. Allah said something and wrote it down in a book and sent it to one illiterate in a locality in Arabia Asia, isnt it? You like thinking you're intelligent, but even a 10 year old boy can quickly see how slow your mind is. You have obviously shot yourself in the foot.

While you yourself quoted that I supplied an experiment, synthetic DNA that are both my facts, all you had to show us is that in a trash book, Allah said something, therefore Allah exists. cheesy cheesy grin grin

Go and sit down in a closet and ask yourself countless times if you're making sense at all in the simplest ways possible, ask yourself o. cheesy
Re: Atheism Is Foolishness? by sino(m): 1:09pm On Feb 06, 2019
Akin1212:
I am almost getting tired responding with the same thing to your mediocre mind. Once again there is no faith being exercised where there is objective evidence. Scientific theories don't need to be believed, they need to be understood!
The joke is on you, contrary to what you have written about science not being believed, your post suggest you don't even understand the science! Hence the need for a faith in science! You have repeatedly showed lack of understanding of the science you present!


Akin1212:
Ad hominem. Why attribute it to me? Did I ever say I want you to 'believe' anything? If yes, could you please point to where I said that? I have only told you that Abiogenesis is the scientific theory based on series of experiments that have hard facts. Do you even need to believe anything, or are you cursed to believe everything?

In the course of running abiogenesis down your weak mind, I explained many scientific facts and truths, such as what all living things are made up of etc. It's not my fault that you cannot comprehend, Mr.
Your posts are always riddled with ad hominem, but hey, it doesn't matter, because you are way over your head with your ego...

You presented your supposed hard evidence to support your claim, and I critic them as not being enough to arrive at your conclusion! Theories are meant to be falsifiable, there is no absolute truth when it come to some of these theories and even supposed facts, especially when there is still room for more research! When you reach that level of intellectual humility, you won't come on a faceless forum to be bragging about research you know next to nothing about other than reading excerpts from online news blogs!

Akin1212:
Lol, when you see ignorance, you know it. Are you trying to deceive the lay people by using the word 'alive' as regarding amino acids? I won't even respond to that hysterical baloney. The conditions of the early earth were not assumed. Read more bro
Instead of providing the supposed incontrovertible evidences, Mr. 'Scientist' goes on personal attacks, you keep proving you know next to nothing about these researches...You should rather take your advice and perhaps save yourself from this embarrassment!


Akin1212:
Presuppositions again, a design only needs a designer, perhaps a DNA need a DNAer? cheesy

The first failure of logic here is to call a DNA a design, throw that babble out the window, please. When you're ready to discuss about the things you have zero knowledge about, we'll discuss it.
You obviously think man is the only living thing on earth. Lol, perhaps you're driven by the egoistic, vaguely purposeful life you're living to think of man alone as the center of all living things? Lwkmd. Wake up bro, it's not about typing grammar and epistles.
Mr. biochemist, what did the researchers do with the computer to 'create' the synthetic DNA?! Again, no substance in your response, at this rate I can clearly see that you are actually bereft of any biochemistry knowledge...If not so, you must have been taught a bit about structures of biomolecules, specifically the DNA molecule being a double stranded helix with proportional measurements and angles. If you have any form of advance studies in biochemistry, you would have been introduced to biophysics of the DNA molecule...Wait, aren't you the biochemist here?!

You absolutely have no clue! Just tell me how a base pair took a supposed intelligent human after extensive studies of the DNA, and numerous failures, more than 2 decades, and 3 billion base pairs was just from a random occurrence?! Were there failures too?! and what kept this random process to continue so as to create these COMPLEXITY and DIVERSITY (since you didn't see this before) we now see?! What sort of randomness brought all these things to work together so astonishingly and awesomely?! Billions of years isn't an answer, for no matter how long you keep writing alphabets randomly, you can't write a best selling novel even a primary school level story book!


Akin1212:
Artificial life is history. I knew you know nothing than to come here and make noise.

https://www.telegraph.co.uk/news/science/7745868/Scientist-Craig-Venter-creates-life-for-first-time-in-laboratory-sparking-debate-about-playing-god.html

You don't even understand how reactions work, talk more of the formation of nucleic acids. You think it takes place in one day? The formation of nucleic acids still take place inside humans and all living things including plants, but only this time it uses enzymes which make the reactions faster. I can't be teaching you biochemistry na, your ignorance is clearly written on the wall. Only if you approach your bold claims of your god existing this way lol. Science does not need to create a life for you to accept the truth, they only need to show processes with concrete evidence. Which have been shown already. But because you're still carrying about your childhood fears and fantasy, your mind is not open enough to accept the facts presented before you. However, how many concrete evidence have you provided for the existence of this your creator?
Wow, I don't understand how reactions work or the biosynthesis of nucleic acids?! Pray tell, how did you arrive at this conclusion?!

What Craig Venter did was to copy already existing DNA, synthesize it in the lab add watermarks and then incorporate it into an already existing cell! He even used the computer software as an analogy, so Mr. biochemist, if I took an OS say ubuntu, which is open source by the way, and make some changes like the welcome screen to show my name, that means I have created a computer?! As I have said earlier, synthesizing DNA in a testube does not mean you have 'created' life!

Your evidences thus far hasn't proven abiogenesis, you were told earlier that there is still a long way to go, even the researchers were humble enough to acknowledge their limitations, but you who is just reading online blogs is all over here bragging!

You said science doesn't need to 'create' life before I accept that it is the truth, but you are the one always demanding such incontrovertible proves and evidences before you accept anything as true, the evidences of the supposed processes you have provided thus far does not prove abiogenesis! So until you can provide the objective evidences to show abiogenesis, you are just believing it based on faith!

Let me help you understand your ignorant bragging here:

Akin 1212: "Artificial life is history." Provides evidence from a researcher called Craig Venter

What Craig Venter et al. did: "Then in 2010 they made the first self-replicating synthetic organism, manufacturing a version of M. mycoides’ genome and then transplanting it into a different Mycoplasma species. The synthetic genome took over the cell, replacing the native operating system with a human-made version. The synthetic M. mycoides genome was mostly identical to the natural version, save for a few genetic watermarks—researchers added their names and a few famous quotes, including a slightly garbled version of Richard Feynman’s assertion, “What I cannot create, I do not understand.”

With the right tools finally in hand, the researchers DESIGNED a set of genetic blueprints for their minimal cell and then tried to build them. Yet “not one design worked,” Venter said. He saw their repeated failures as a rebuke for their HUBRIS. Does modern science have sufficient knowledge of basic biological principles to build a cell? “The answer was a resounding NO,” he said." (Emphasis are mine)

For emphasis, “To my mind Craig has somewhat[b] overplayed the importance of this[/b],” said David Baltimore, a leading geneticist at Caltech. Dr. Baltimore described the result as “a technical tour de force” but not breakthrough science, but just a matter of scale…. “He has not created life, only mimicked it,” Dr. Baltimore said."

Indeed, artificial life is history according to our own nairaland 'distinguished' biochemist grin

Akin1212:
Lol, as usual. Allah said something and wrote it down in a book and sent it to one illiterate in a locality in Arabia Asia, isnt it? You like thinking you're intelligent, but even a 10 year old boy can quickly see how slow your mind is. You have obviously shot yourself in the foot.

While you yourself quoted that I supplied an experiment, synthetic DNA that are both my facts, all you had to show us is that in a trash book, Allah said something, therefore Allah exists. cheesy cheesy grin grin

Go and sit down in a closet and ask yourself countless times if you're making sense at all in the simplest ways possible, ask yourself o. cheesy
I had already presumed your response, you guys are easily predictable, and the level of my intelligence is way beyond your likes that read headlines to arrive at spurious conclusions! The real scientists are still very much uncertain about the origin of life, they are yet to prove the origin of life from non living materials, and show the process, but you my friend believe, afterall, according to you, "the truth about science is that it is true, whether anyone accept it or not" Just as any theist would say, the truth about my religion is that it is true, whether you accept it or not!
Re: Atheism Is Foolishness? by Akin1212(m):
sino:
The joke is on you, contrary to what you have written about science not being believed, your post suggest you don't even understand the science! Hence the need for a faith in science! You have repeatedly showed lack of understanding of the science you present!
Sigh, once again I have to address mediocrity.

Not much to say here, you're only explaining what you perceived. Not really worth responding to.

sino:
Your posts are always riddled with ad hominem, but hey, it doesn't matter, because you are way over your head with your ego...

You presented your supposed hard evidence to support your claim, and I critic them as not being enough to arrive at your conclusion! Theories are meant to be falsifiable, there is no absolute truth when it come to some of these theories and even supposed facts, especially when there is still room for more research! When you reach that level of intellectual humility, you won't come on a faceless forum to be bragging about research you know next to nothing about other than reading excerpts from online news blogs!
You critic the evidence or you critic me? Lol, we will have a breakthrough when you stop attacking me and instead focus on the matter. You cannot drive home your points by attacking me or attacking what I studied in school. It is unbecoming to the hopes of you unlearning, learning and relearning. And you really need to.

If you critic provided evidence, then why can't we critic your belief. Evidence is more reliable than mere faith which is totally based on 'the prophet says Allah said,' just hearsays.

Theories are meant to be falsified based on further research and experiments, not by a random Sino on Nairaland.

It surprises me that you of all people is saying there is no absolute truth when it comes to scientific theories, but the same you actually believes that Islam that is rejected by over 5 billion people in the world is an absolute truth. cheesy. It says so much about your intellectual truth and humility. Scientific theories with evidence are being rejected by the likes of you who lack understanding of them because you have sworn to adhere to fantasies and fairy tales, just as the one we did before we were allowed to comment in this section.

Scientific theories are open to further research and questioning, and that's the honest thing about science. It has to be true here in Africa and also in Asia. Unlike your religion which is only true in certain places in the world and is very much closed to criticism and questioning. Isn't it?

That I know close to nothing about the scientific research I quote here, you can continue throwing jabs if it makes your day lol, but it doesn't change the fact that Allah does not exist anywhere.

That's why they are called references my friend. The journals are online, detailed processes of how the work was carried out, the apparatus and materials used, how the conclusions were reached etc are available for anyone who wants to reproduce the work. That's clearly the highest form of honesty. And Sino, that obviously is better than saying we cannot see God bla bla bla, better than saying only the prophets can hear from God bla bla bla.

sino:
Instead of providing the supposed incontrovertible evidences, Mr. 'Scientist' goes on personal attacks, you keep proving you know next to nothing about these researches...You should rather take your advice and perhaps save yourself from this embarrassment!
I guess I should stop taking you serious. Who takes someone who does cognitive dissonance serious?
After saying I provided some experiments as facts, after saying I provided the arrangement of synthetic DNA as facts, what other evidence are you asking for? Or what evidence have you provided for your claims?

Saying amino acids are alive is tantamount to committing an intellectual suicide. I don't know how to save you from that than to bury you. RIP.

sino:
Mr. biochemist, what did the researchers do with the computer to 'create' the synthetic DNA?! Again, no substance in your response, at this rate I can clearly see that you are actually bereft of any biochemistry knowledge...If not so, you must have been taught a bit about structures of biomolecules, specifically the DNA molecule being a double stranded helix with proportional measurements and angles. If you have any form of advance studies in biochemistry, you would have been introduced to biophysics of the DNA molecule...Wait, aren't you the biochemist here?

You absolutely have no clue! Just tell me how a billion base pairs was just from a random occurrence?! Were there failures too?! and what kept this random process to continue so as to create these COMPLEXITY and DIVERSITY (since you didn't see this before) we now see?! What sort of randomness brought all these things to work together so astonishingly and awesomely?! Billions of years isn't an answer, for no matter how long you keep writing alphabets randomly, you can't write a best selling novel even a primary school level story book!
You just have to always introduce a certain level of ignorance to science whenever you struggle to describe it by introducing your creator theory. This same you believes that the creator designed everything but the creator was designed from nothing or not designed at all. grin. This is the highest level of dissonance I have ever come across. Yet, you have zero evidence of this creator.

Researchers arranged DNA strand with the computer, does that make them designers or researchers? When you don't take your time to think deeply, you will always be a joke. grin

Lol the twist angles or the angles of rotation of the DNA double stranded molecule is not a proof that someone did it, it is a proof that the DNA consists of non living atoms that bond with themselves. When atoms form bond with themselves, as a result of repulsion, angles are formed. And since the atoms are repeated in the DNA molecule, the angles will be uniform. Don't always fill the gap of knowledge with fantasies.

Again, you're shooting yourself in the foot. It took 3 billion years after the formation of the planet earth for man to surface. In 3 billion years which is close to forever, there's every chance that man could come or something else could come, but man came. It was a chance, or do we need to explain chances for you again? Man was not the first form of life, and the randomness obviously produced diversities of life, which is about 8.7 million species. What's so hard in understanding this? Life is the random occurrence and it happened, so deal with it.

sino:
Wow, I don't understand how reactions work or the biosynthesis of nucleic acids?! Pray tell, how did you arrive at this conclusion?!

What Craig Venter did was to copy already existing DNA, synthesize it in the lab add watermarks and then incorporate it into an already existing cell! He even used the computer software as an analogy, so Mr. biochemist, if I took an OS say ubuntu, which is open source by the way, and make some changes like the welcome screen to show my name, that means I have created a computer?! As I have said earlier, synthesizing DNA in a testube does not mean you have 'created' life!

Your evidences thus far hasn't proven abiogenesis, you were told earlier that there is still a long way to go, even the researchers were humble enough to acknowledge their limitations, but you who is just reading online blogs is all over here bragging!

You said science doesn't need to 'create' life before I accept that it is the truth, but you are the one always demanding such incontrovertible proves and evidences before you accept anything as true, the evidences of the supposed processes you have provided thus far does not prove abiogenesis! So until you can provide the objective evidences to show abiogenesis, you are just believing it based on faith!

Let me help you understand your ignorant bragging here:

Akin 1212: "Artificial life is history." Provides evidence from a researcher called Craig Venter

What Craig Venter et al. did: "Then in 2010 they made the first self-replicating synthetic organism, manufacturing a version of M. mycoides’ genome and then transplanting it into a different Mycoplasma species. The synthetic genome took over the cell, replacing the native operating system with a human-made version. The synthetic M. mycoides genome was mostly identical to the natural version, save for a few genetic watermarks—researchers added their names and a few famous quotes, including a slightly garbled version of Richard Feynman’s assertion, “What I cannot create, I do not understand.”

With the right tools finally in hand, the researchers DESIGNED a set of genetic blueprints for their minimal cell and then tried to build them. Yet “not one design worked,” Venter said. He saw their repeated failures as a rebuke for their HUBRIS. Does modern science have sufficient knowledge of basic biological principles to build a cell? “The answer was a resounding NO,” he said." (Emphasis are mine)

For emphasis, “To my mind Craig has somewhat[b] overplayed the importance of this[/b],” said David Baltimore, a leading geneticist at Caltech. Dr. Baltimore described the result as “a technical tour de force” but not breakthrough science, but just a matter of scale…. “He has not created life, only mimicked it,” Dr. Baltimore said."

Indeed, artificial life is history according to our own nairaland 'distinguished' biochemist grin
Lmao grin. SIno, Sino, you went through all these to present a lie? I'll make it easy for you and anyone reading. I will quote the first paragraph of the source, I will then define abiogenesis, I will then quote some other paragraphs of the source and then I will finally address your baloney once more. Here we go....

First paragraph of the source : "Dr Craig Venter, a multi-millionaire pioneer in genetics, and his team have managed to make a completely new "synthetic" life form from a mix of chemicals."

Definition of Abiogenesis : "Abiogenesis, or informally the origin of life, is the natural process by which life has arisen from non-living matter, such as simple organic compounds."

From the above, we have seen that Craig Venter and his team made a completely new synthetic life form from a mix of chemicals, and we have also seen that abiogenesis is the natural process of making life from simple organic compounds.

But our dear Sino has quoted something else entirely, dishonestly explaining what the article or source does not explain. Why do you lie to yourself Sino?

Further quotes from the source : "They manufactured a new chromosome from artificial DNA in a test tube, then transferred it into an empty cell and watched it multiply – the very definition of being alive." --- From synthetic DNA that was arranged, they made a new chromosome that was able to divide and multiply. This however quenches the arguments that life comes from God, and further validates the scientific position that life is just a series of reactions or processes.

Further quotes from the source : "The man-made single cell "creature", which is a modified version of one of the simplest bacteria on earth, proves that the technology works."----- The cell is completely man made from scratch and it is a prototype of the simplest bacteria on earth, but this one is modified with watermarks to differentiate it from the natural bacteria.

Further quotes from the source : "First they sequenced the genetic code of Mycoplasma genitalium, the world's smallest bacteria that lives in cattle and goats, and stored the information on a computer."--- They looked at the genetic code of the smallest bacteria in the world and sequenced it. Gene sequencing is the process of identifying how the nucleotides are arranged in the DNA of a cell. They copied the code, which are just a series of lettered representation of nucleotides, I will attach a sample picture. As against the baloney our pseudoscientist Sino wrote up there. This is synonymous to looking at the code that was used to produce one OS and use the same code to produce your own OS. Haven't you created a new Computer? Sino is very very dishonest, and at this point, it's becoming a waste of time discussing with someone who is intellectually dishonest.

The genetic code stored in a computer is always like this - ATTCGAGTACTTAAACTATTTGGGCGTACGTAGCTGACAGTACGT

Here is the source again ---- https://www.telegraph.co.uk/news/science/7745868/Scientist-Craig-Venter-creates-life-for-first-time-in-laboratory-sparking-debate-about-playing-god.html

sino:
I had already presumed your response, you guys are easily predictable, and the level of my intelligence is way beyond your likes that read headlines to arrive at spurious conclusions! The real scientists are still very much uncertain about the origin of life, they are yet to prove the origin of life from non living materials, and show the process, but you my friend believe, afterall, according to you, "the truth about science is that it is true, whether anyone accept it or not" Just as any theist would say, the truth about my religion is that it is true, whether you accept it or not!
Oh, there he goes again. The story of how his level of intelligence is greater than ours, and he cannot easily tell a lie when he sees one. How a book sent by invisible angels by invisible Allah beats years of work carried out in the lab is a nice place to hide for an intelligent person like Sino. grin

From the source again : "Professor Julian Savulescu, an expert in Practical Ethics at the University of Oxford, said: “Venter is creaking open the most profound door in humanity’s history, potentially peeking into its destiny.

"He is going toward the role of a god: creating artificial life that could never have existed naturally."


This is the first synthetic cell that's been made, and we call it synthetic because the cell is totally derived from a synthetic chromosome, made with four bottles of chemicals on a chemical synthesizer, starting with information in a computer(lettered codes)," said Dr Venter.

It is evident that scientists have made it known and even demonstrated that life can be created from chemicals, non living materials. But our intelligent Sino who is also a bogus liar said they haven't. Who would take such a person serious?

Sino, you're very correct that we say science is true whether you believe it or not, you are an evidence of that. If not for science, we won't even be doing this on the internet, would we?
If not for science you will not be struggling to discredit the work of Craig Venter and be misrepresenting it here on Nairaland with sheer dishonesty. You must have faith and fantasy to have such dishonesty. Lol.

However, the only counter explanation you have is that Allah did it, because it was written by an illiterate 1400 years ago. Is that even sensible? Why not just scrutinize this Allah did it excuse as much as you're scrutinizing abiogenesis? Why not provide testable evidence or plausible explanations of how this Allah did it?

On the basis of abiogenesis, there's more plausibility and objectivity than your excuse of Allah. You just want us to accept that Allah did it and not ask questions? But you're quick to throw 100s of questions my way, but I still answered them. You on the other hand would only quote a verse from your trash book either telling us that our knowledge is too small to know or that we shouldn't question Allah. Perhaps your brain is too low to carry the explanations given on abiogenesis too. Lol

But what do we even know sef, sheybi you're the most intelligent. grin

Attached below is a sample genetic code usually stored in the computer.

Re: Atheism Is Foolishness? by tintingz(op): 7:40pm On Feb 06, 2019
Akin1212, wow, I wish I studied science.

Anyways, our brother Sino is yet to explain how he knows Allah was the one that created him, with empirical evidence.
Re: Atheism Is Foolishness? by Akin1212(m): 8:16pm On Feb 06, 2019
tintingz:
Akin1212, wow, I wish I studied science.

Anyways, our brother Sino is yet to explain how he knows Allah was the one that created him, with empirical evidence.
Lol, science is beautiful. The fact that it studies our natural world alone is incomparable to anything. Without science we wouldn't be here at all. If we were to rely on all these fantasies and fairy tales, we wouldn't have done anything.

Sino cannot provide any evidence, that's why his counter arguments are to attack my personality as a biochemist and to discredit us by saying we also believe scientific facts because we were not the ones who did the research. Indirectly, he is saying every scientist must do the research they want to promote. cheesy. He has failed to realize the objectivity of science. Scientists try as much as possible to be objective in everything they do, hence the publishing of journals. You must provide detailed information about what you did, that's one of the 5 rules of a research, it must be reproducible, else it's not accepted. This changes everything because in religion, only selected few can be prophets. God will never talk to ordinary people, how can God expect me to listen to an illiterate Arabic man when I cannot even speak Arabic. So I must learn Arabic because I want to know God? God cannot speak to me or someone from my locality too? It's all laughable, you know.

And not to forget, another intelligent Sino's argument is that Allah did it and that's because it was written by Mohammed from Arabia grin. Lmao.

Okay, we need a plausible hypothetical mechanism of how Allah did it, abi? I think we know his response already, we cannot know because our knowledge is too small compared to the information grin
Re: Atheism Is Foolishness? by tintingz(op): 9:34pm On Feb 06, 2019
Akin1212:
Lol, science is beautiful. The fact that it studies our natural world alone is incomparable to anything. Without science we wouldn't be here at all. If we were to rely on all these fantasies and fairy tales, we wouldn't have done anything.

Sino cannot provide any evidence, that's why his counter arguments are to attack my personality as a biochemist and to discredit us by saying we also believe scientific facts because we were not the ones who did the research. Indirectly, he is saying every scientist must do the research they want to promote. cheesy. He has failed to realize the objectivity of science. Scientists try as much as possible to be objective in everything they do, hence the publishing of journals. You must provide detailed information about what you did, that's one of the 5 rules of a research, it must be reproducible, else it's not accepted. This changes everything because in religion, only selected few can be prophets. God will never talk to ordinary people, how can God expect me to listen to an illiterate Arabic man when I cannot even speak Arabic. So I must learn Arabic because I want to know God? God cannot speak to me or someone from my locality too? It's all laughable, you know.

And not to forget, another intelligent Sino's argument is that Allah did it and that's because it was written by Mohammed from Arabia grin. Lmao.

Okay, we need a plausible hypothetical mechanism of how Allah did it, abi? I think we know his response already, we cannot know because our knowledge is too small compared to the information grin
Lol, I've been arguing with him for long.

He claim he studied science fine, but his posts are like pseudo-scientific claims. He's quick to attack science and discredit their research. I wonder if he understand what scientific theory means, if he understand a scientific consensus. He thought atheists take science as a religion or so. grin

But ask him to provide evidence for his God existence and creation, he will start jumping from one fallacy to another fallacy and the ridiculous thing is his fellow Muslims will jump in the thread cheerleading his fallacies and join him with fallacies.

That's why i make sure my argument are strictly base on logic, the only way to argue moderately when you're in a den of fantasy thinking people is to use logic and know every fallacy they commit.

Just ask him to provide evidence for all the claims in their fairy book and see him run pass Usain bolt. grin
Re: Atheism Is Foolishness? by Akin1212(m): 12:05am On Feb 07, 2019
tintingz:
Lol, I've been arguing with him for long.

He claim he studied science fine, but his posts are like pseudo-scientific claims. He's quick to attack science and discredit their research. I wonder if he understand what scientific theory means, if he understand a scientific consensus. He thought atheists take science as a religion or so. grin

But ask him to provide evidence for his God existence and creation, he will start jumping from one fallacy to another fallacy and the ridiculous thing is his fellow Muslims will jump in the thread cheerleading his fallacies and join him with fallacies.

That's why i make sure my argument are strictly base on logic, the only way to argue moderately when you're in a den of fantasy thinking people is to use logic and know every fallacy they commit.

Just ask him to provide evidence for all the claims in their fairy book and see him run pass Usain bolt. grin
I realized he studied science but someone like him must have studied not to learn but to just go to school. You could obviously see his pseudoscientific traits.

How can someone who actually learnt science not know what an evidence is? Nobody's word is an evidence, not even Mohammed's. They only believe in his fantasies.

Anyway, let me join you in waiting for the evidence he will provide for the existence of his God and how life started on earth. grin
Re: Atheism Is Foolishness? by usermane(m):
Akin1212:
If you don't do research but base your faith in old books that were written thousands of years ago, information will always elude you. There is still a long way to go, says who? Are you a researcher? The synthesis of life or a cell is history in the science world, stop deceiving yourself. The emergence of life or complex cell like a bacteria was not a single event, it takes time and special conditions, we don't need to synthesize a new bacteria from scratch for people like you to accept abiogenesis, that's not the aim, and because you want to see it happen does not mean it will be done, else you must also be ready to talk to your God to be ready to send down the manual he also used to create Adam and Eve down to earth too because we also need a plausible hypothetical mechanism of how he did it as you have claimed. The truth about science is that, it is true, whether you accept it or not.

https://www.independent.co.uk/news/science/artificial-life-synthetic-dna-scientists-living-organisms-create-scripps-research-institute-floyd-a8083966.html
Hmmm....! Didn't know about this, despite all my inquiries into abiogenesis previously. I'll need to verify the veracity, though.


That extraterrestrials cooked up man is just another nonsense, prove it.
For a man so sure of abiogenesis, should it be too hard to see the earth's biomes as end yield of alien lab work? Could these highly advanced and intelligent aliens be whom the theists perceive as God?

If religion is restricted to individual beliefs then no one will be disturbed. But when it comes to where they will now say those who don't share the belief with them will suffer forever in hell is where we will have problem. Everyone should worship their own god and go to their own heaven or hell. But is that how it is? How come you now said religion is an individual thing?
Oh, I was talking about how individual experiences shape their beliefs. People who are very religious can share many stories of how they feel this special connection to God. A sort of supernatural force that they can't explain but they can feel through their worship and prayers.

Theists are basically stupid people, cognitive bias will not let them have peace. Can a loving and merciful God be a punisher? I don't need to overflog this particular issue. You can't be white and also be black at the same time.
Why? Can't a loving father punish his son?

You see what am saying? It just doesn't end. For almost every flaw you find, theists seem to find a way around it. And so, as atheist, you're forever trapped in this endless loop.
Re: Atheism Is Foolishness? by usermane(m): 1:53pm On Feb 07, 2019
tintingz:
That story is ridiculous and nonsensical.

What purpose does God who's all-knowing wants to gain in testing job's life when he already knows the outcome of it. He already knows every action and decisions of job. This same nonsense also apply to Abraham commanded by God to slaughter his son.

God is doing what he hate and yet command these people to do what he hate. Doesn't make any sense! Is God malevolent or confused?
I agree to your point on divine test or trial. But the divine punishment, you should be able to grasp that. Unless of course, it happens to poor little or innocent people. In that case, I think you we should also remember another side to the topic. That is, God may let hardship and misfortune happen, not as punishment or test, but as divine lessons for man. You know, to lead man to correct himself or his affairs.

If something cannot be rationalized then it doesn't make any sense and should be discarded.
I depends on the thing, its worth. Even in science, there are certain things that are applied even though the full science is not rational. Since worthy to one man may be unworthy to one other, you find people clinging to what you rejected as myth.
Re: Atheism Is Foolishness? by sino(m): 3:21pm On Feb 07, 2019
Akin1212:
You critic the evidence or you critic me? Lol, we will have a breakthrough when you stop attacking me and instead focus on the matter. You cannot drive home your points by attacking me or attacking what I studied in school. It is unbecoming to the hopes of you unlearning, learning and relearning. And you really need to.

If you critic provided evidence, then why can't we critic your belief. Evidence is more reliable than mere faith which is totally based on 'the prophet says Allah said,' just hearsays.

Theories are meant to be falsified based on further research and experiments, not by a random Sino on Nairaland.

It surprises me that you of all people is saying there is no absolute truth when it comes to scientific theories, but the same you actually believes that Islam that is rejected by over 5 billion people in the world is an absolute truth. cheesy. It says so much about your intellectual truth and humility. Scientific theories with evidence are being rejected by the likes of you who lack understanding of them because you have sworn to adhere to fantasies and fairy tales, just as the one we did before we were allowed to comment in this section.

Scientific theories are open to further research and questioning, and that's the honest thing about science. It has to be true here in Africa and also in Asia. Unlike your religion which is only true in certain places in the world and is very much closed to criticism and questioning. Isn't it?

That I know close to nothing about the scientific research I quote here, you can continue throwing jabs if it makes your day lol, but it doesn't change the fact that Allah does not exist anywhere.

That's why they are called references my friend. The journals are online, detailed processes of how the work was carried out, the apparatus and materials used, how the conclusions were reached etc are available for anyone who wants to reproduce the work. That's clearly the highest form of honesty. And Sino, that obviously is better than saying we cannot see God bla bla bla, better than saying only the prophets can hear from God bla bla bla.
Lol, attacking you by stating what you were bragging about with no one asking you in the first place?! Are you not a biochemist again?! So what is the attack here?!

Well the fact still remains that scientific theories and even facts are falsifiable, and this happens to be an integral part of the scientific method. I do not reject scientific theories or facts, I understand the limits and when there are further researches that questions the veracity of previous theories or there happens to be more questions arriving from a research that aims at proving a theory, I acknowledge them and use such to critic the likes of you who hold on to science as the absolute truth. The Qur’an which I believe to be true hasn’t changed from inception, but I can mention many scientific theories that had to be reviewed or rejected! This supports the obvious truth I had quoted in the Qur’an that science as well as man seeking the origin of the universe as well as life are perpetually uncertain!

I do not like throwing jabs at anyone, but you are quite notorious for your condescending approach as well as making mockery of what I believe, I know it makes you feel intelligent more than a theist, but how come you are feeling insulted when I do the same about your person?! Does being an atheist mean you shouldn’t employ decorum when engaging in discussion especially on a faceless forum?!

My issue is not the fact that these researches aren’t available, but the fact that you are making spurious conclusions which is actually different from what the research is all about. I do not just read one article, especially from a blog to start bragging what the research is all about; I dig deeper, going straight to other reports as well as the research paper itself! Then I make an informed opinion.

Akin1212:
I guess I should stop taking you serious. Who takes someone who does cognitive dissonance serious?
After saying I provided some experiments as facts, after saying I provided the arrangement of synthetic DNA as facts, what other evidence are you asking for? Or what evidence have you provided for your claims?

Saying amino acids are alive is tantamount to committing an intellectual suicide. I don't know how to save you from that than to bury you. RIP.
Of course you couldn’t refute the other points I raised which is actually backed up by further research, but rather hold on to amino-acids being ‘alive’ as an easy way out. Please tell me how the Urey-Miller experiment proves abiogenesis?! How did the supposed racemic amino-acids give rise to life?! No scratch that, what were the amino-acids produced and how did this experiment account for at least 50% of the amino-acids required to synthesize necessary proteins that are essential for life?! Again how did the polymerization of these amino-acids happen?! These are part of the questions my ‘alive’ was referring to, but it doesn’t matter to you, if the experiment as well as further experiments cannot answer these questions and even more, then you are believer, having blind faith in science!

Akin1212:
You just have to always introduce a certain level of ignorance to science whenever you struggle to describe it by introducing your creator theory. This same you believes that the creator designed everything but the creator was designed from nothing or not designed at all. grin. This is the highest level of dissonance I have ever come across. Yet, you have zero evidence of this creator.

Researchers arranged DNA strand with the computer, does that make them designers or researchers? When you don't take your time to think deeply, you will always be a joke. grin

Lol the twist angles or the angles of rotation of the DNA double stranded molecule is not a proof that someone did it, it is a proof that the DNA consists of non living atoms that bond with themselves. When atoms form bond with themselves, as a result of repulsion, angles are formed. And since the atoms are repeated in the DNA molecule, the angles will be uniform. Don't always fill the gap of knowledge with fantasies.

Again, you're shooting yourself in the foot. It took 3 billion years after the formation of the planet earth for man to surface. In 3 billion years which is close to forever, there's every chance that man could come or something else could come, but man came. It was a chance, or do we need to explain chances for you again? Man was not the first form of life, and the randomness obviously produced diversities of life, which is about 8.7 million species. What's so hard in understanding this? Life is the random occurrence and it happened, so deal with it.
The joke is on you Mr. Scientist, the research and researchers you are referring me to use the word design repeatedly through their research article, perhaps they were stupid to have used such a word?! You don’t get it, when you make use of structures to describe something, you are inadvertently acknowledging there is a design, a pattern, be it uniform or not (but this case uniform). These bonds are quite important for the functions of these macromolecules, and in the DNA, it isn’t just random bonding, but information-driven bonding which enables it to function optimally with respect to its replication and transcription. The bonds, the number of base pairs per turn, the form found in physiology are so unique and important that you can’t deny the intelligence! You ought to know about structures and functions na, but alas! Here we are… What the researchers have been able to do is study and learn from a naturally occurring DNA (genome), designed their own with the aid of a computer! If they say they design, who are you to question this?! And of course if they actually had to design one, common sense dictates that the naturally occurring one must have also been designed! Oh i forgot, common sense they say, isn't common!

Life happened no doubt, but my question is given similar billions of years, and with 26 alphabets to be randomly written, what would be the chances of writing a best-selling novel as well as other diverse meaningful story books, letters etc.?! Does it look plausible to you?! From the single unicellular organisms to the complex multicellular organisms, do you see any purposeless living organism?! How did this randomness ‘create’ such a working order using just 4 ‘alphabets’?! That is the big question your randomness and chance are yet to answer!

Akin1212:
Lmao grin. SIno, Sino, you went through all these to present a lie? I'll make it easy for you and anyone reading. I will quote the first paragraph of the source, I will then define abiogenesis, I will then quote some other paragraphs of the source and then I will finally address your baloney once more. Here we go....

First paragraph of the source : "Dr Craig Venter, a multi-millionaire pioneer in genetics, and his team have managed to make a completely new "synthetic" life form from a mix of chemicals."

Definition of Abiogenesis : "Abiogenesis, or informally the origin of life, is the natural process by which life has arisen from non-living matter, such as simple organic compounds."

From the above, we have seen that Craig Venter and his team made a completely new synthetic life form from a mix of chemicals, and we have also seen that abiogenesis is the natural process of making life from simple organic compounds.

But our dear Sino has quoted something else entirely, dishonestly explaining what the article or source does not explain. Why do you lie to yourself Sino?

Further quotes from the source : "They manufactured a new chromosome from artificial DNA in a test tube, then transferred it into an empty cell and watched it multiply – the very definition of being alive." --- From synthetic DNA that was arranged, they made a new chromosome that was able to divide and multiply. This however quenches the arguments that life comes from God, and further validates the scientific position that life is just a series of reactions or processes.

Further quotes from the source : "The man-made single cell "creature", which is a modified version of one of the simplest bacteria on earth, proves that the technology works."----- The cell is completely man made from scratch and it is a prototype of the simplest bacteria on earth, but this one is modified with watermarks to differentiate it from the natural bacteria.

Further quotes from the source : "First they sequenced the genetic code of Mycoplasma genitalium, the world's smallest bacteria that lives in cattle and goats, and stored the information on a computer."--- They looked at the genetic code of the smallest bacteria in the world and sequenced it. Gene sequencing is the process of identifying how the nucleotides are arranged in the DNA of a cell. They copied the code, which are just a series of lettered representation of nucleotides, I will attach a sample picture. As against the baloney our pseudoscientist Sino wrote up there. This is synonymous to looking at the code that was used to produce one OS and use the same code to produce your own OS. Haven't you created a new Computer? Sino is very very dishonest, and at this point, it's becoming a waste of time discussing with someone who is intellectually dishonest.

The genetic code stored in a computer is always like this - ATTCGAGTACTTAAACTATTTGGGCGTACGTAGCTGACAGTACGT

Here is the source again ---- https://www.telegraph.co.uk/news/science/7745868/Scientist-Craig-Venter-creates-life-for-first-time-in-laboratory-sparking-debate-about-playing-god.html
You have just shown that you lack the understanding of the science in the research, but merely do follow-follow. So if I copy windows OS to write a code for my own OS, Did I create a new computer or a new OS?! Don’t you know the difference between Hardware and software ni?! You see, I omitted the reference for my quoted post for a reason, to weigh your understanding of what is being discussed here and not some propaganda believes about abiogenesis…. I will help you with quotes from the original research paper, the abstract and part of their discussion and conclusion, then you must show where I lied! Please take note of the word DESIGN!

DESIGN and synthesis of a minimal bacterial genome

Abstract

We used whole-genome DESIGN and complete chemical synthesis to minimize the 1079–kilobase pair synthetic genome of Mycoplasma mycoides JCVI-syn1.0. An initial DESIGN, based on collective knowledge of molecular biology combined with limited transposon mutagenesis data, failed to produce a viable cell. Improved transposon mutagenesis methods revealed a class of quasi-essential genes that are needed for robust growth, explaining the failure of our initial DESIGN. Three cycles of DESIGN, synthesis, and testing, with retention of quasi-essential genes, produced JCVI-syn3.0 (531 kilobase pairs, 473 genes), which has a genome smaller than that of any autonomously replicating cell found in nature. JCVI-syn3.0 retains almost all genes involved in the synthesis and processing of macromolecules. Unexpectedly, it also contains 149 genes with unknown biological functions. JCVI-syn3.0 is a versatile platform for investigating the core functions of life and for exploring whole-genome DESIGN.

So does this explain abiogenesis?! Let’s go further into the article....

"Genomics is moving from a descriptive phase, in which genomes are sequenced and analyzed, to a synthetic phase, in which whole genomes can be built by chemical synthesis. As the detailed genetic requirements for life are discovered, it will become possible to design whole genomes from first principles, build them by chemical synthesis, and then bring them to life by installation into a receptive cellular environment. We have applied this whole-genome design and synthesis approach to the problem of minimizing a cellular genome."

The bold might be a little bit confusing, but I’ll explain, you see the synthetic genome is what is built from scratch, of course with the help of learning from the original design, and this did not form a life on its own as it would be shown later…

"In contrast, we set out to construct a minimal cellular genome in order to experimentally determine a core set of genes for an independently replicating cell. We designed a genome using genes from M. mycoides JCVI-syn1.0 (10). This mycoplasma cell has several advantages for this purpose. First, the mycoplasmas already have very small genomes. They have evolved from gram-positive bacteria with larger genomes by losing genes that are unnecessary in their niche as mammalian parasites. They are already far along an evolutionary pathway to a minimal genome, and consequently they are likely to have fewer functionally redundant genes than other bacteria. We also have a highly developed set of tools for building this genome and for assembling and manipulating the genome as an extra chromosome in yeast."

The first introduction of this synthetic genome to life can be seen here where it is placed and manipulated in a yeast cell….So what happens after?! Did this genome start functioning as a cell on its own to prove what Mr. Scientist wants us to believe about abiogenesis?!

What actually happened is the transplanting of the manipulated genome into an already existing bacterial cell.

"At each cycle, the genome is built as a centromeric plasmid in yeast, then tested by transplantation of the genome into an M. capricolum recipient." (See attached picture).

Source: Clyde A. Hutchison III et al.Design and synthesis of a minimal bacterial genome Science 351, (2016); DOI: 10.1126/science.aad6253

How does all the above different from what I posted, or how does it show that I lied Mr. Biochemist?!

It is impossible for the synthetic genome to function without the machinery for reading and translating the information embedded in it, further replication after transplantation means that the synthetic genome contain the necessary information to continue living and not starting life from the scratch! The critical question you need to ask yourself is that was the recipient bacteria dead?! FYI, a dead cell cannot and will not translate or read any information transplanted into it! It is just like the OS analogy, if the computer is dead, there is absolutely nothing your new OS will do, except the computer is working, you format the hdd, and then install your own OS! I hope this is clear enough!

Re: Atheism Is Foolishness? by sino(m): 3:21pm On Feb 07, 2019
Akin1212:
Oh, there he goes again. The story of how his level of intelligence is greater than ours, and he cannot easily tell a lie when he sees one. How a book sent by invisible angels by invisible Allah beats years of work carried out in the lab is a nice place to hide for an intelligent person like Sino. grin

From the source again : "Professor Julian Savulescu, an expert in Practical Ethics at the University of Oxford, said: “Venter is creaking open the most profound door in humanity’s history, potentially peeking into its destiny.

"He is going toward the role of a god: creating artificial life that could never have existed naturally."


This is the first synthetic cell that's been made, and we call it synthetic because the cell is totally derived from a synthetic chromosome, made with four bottles of chemicals on a chemical synthesizer, starting with information in a computer(lettered codes)," said Dr Venter.

It is evident that scientists have made it known and even demonstrated that life can be created from chemicals, non living materials. But our intelligent Sino who is also a bogus liar said they haven't. Who would take such a person serious?

Sino, you're very correct that we say science is true whether you believe it or not, you are an evidence of that. If not for science, we won't even be doing this on the internet, would we?
If not for science you will not be struggling to discredit the work of Craig Venter and be misrepresenting it here on Nairaland with sheer dishonesty. You must have faith and fantasy to have such dishonesty. Lol.

However, the only counter explanation you have is that Allah did it, because it was written by an illiterate 1400 years ago. Is that even sensible? Why not just scrutinize this Allah did it excuse as much as you're scrutinizing abiogenesis? Why not provide testable evidence or plausible explanations of how this Allah did it?

On the basis of abiogenesis, there's more plausibility and objectivity than your excuse of Allah. You just want us to accept that Allah did it and not ask questions? But you're quick to throw 100s of questions my way, but I still answered them. You on the other hand would only quote a verse from your trash book either telling us that our knowledge is too small to know or that we shouldn't question Allah. Perhaps your brain is too low to carry the explanations given on abiogenesis too. Lol

But what do we even know sef, sheybi you're the most intelligent. grin

Attached below is a sample genetic code usually stored in the computer.
I would repeat it again; my level of intelligence is way beyond your likes that are very lazy to do any form of research (including reading and understanding a published journal) but come on a faceless forum to brag about being a scientist or a biochemist! I would help you post the primary objective of the research by Venter, to show your ignorance the more:

"Here we report a new cell, JCVI-syn3.0 (abbreviated syn3.0), that is controlled by a 531–kilobase pair (kbp) synthetic genome that encodes 438 proteins and 35 annotated RNAs. It is a working approximation to a minimal cell. Its genome is substantially smaller than that of M. genitalium, and its doubling rate is about five times as fast." (Ibid.)

Craig didn’t claim to have proved abiogenesis, and moreover, he and his team still needed life, that of yeast and a bacterial cell for their synthetic genome to function.

This brings back to the quote from a leading geneticist again:

“To my mind Craig has somewhat overplayed the importance of this,” said David Baltimore, a leading geneticist at Caltech. Dr. Baltimore described the result as “a technical tour de force” but not breakthrough science, but just a matter of scale…. [b]“He has not created life, only mimicked it,” [/b]Dr. Baltimore said."

Instead of all the unnecessary theatrics, long stories and attaching picture of a genetic code (does calling it a code also baloney since a code would definitely require a programmer?!), just show me my bogus lie and how I misrepresented him, don’t come quoting a Professor of practical ethics to me or making spurious claims, rather show how this research by Craig created life from just chemicals to prove abiogenesis!
Re: Atheism Is Foolishness? by Akin1212(m): 3:32pm On Feb 07, 2019
usermane:
Hmmm....! Didn't know about this, despite all my inquiries into abiogenesis previously. I'll need to verify the veracity, though.
Here is another one, I guess you haven't really made your enquiries well enough.

https://www.telegraph.co.uk/news/science/7745868/Scientist-Craig-Venter-creates-life-for-first-time-in-laboratory-sparking-debate-about-playing-god.html

usermane:
For a man so sure of abiogenesis, should it be too hard to see the earth's biomes as end yield of alien lab work? Could these highly advanced and intelligent aliens be whom the theists perceive as God?
And what plausible, objective evidence do you have of these aliens? Or you want me to see by just imagination as usual? You're just cooking upnnew bullshits that's similar to what theists have. Prove your claims and stop deceiving yourself.

usermane:
Oh, I was talking about how individual experiences shape their beliefs. People who are very religious can share many stories of how they feel this special connection to God. A sort of supernatural force that they can't explain but they can feel through their worship and prayers.
No one can explain delusion enough that others will get it. Delusions are always personal. Don't you know?

usermane:
Why? Can't a loving father punish his son?

You see what am saying? It just doesn't end. For almost every flaw you find, theists seem to find a way around it. And so, as atheist, you're forever trapped in this endless loop.
A loving father cannot punish his son. Can a loving father boil 'hot' water to pour on disobedient children? What happens to helping them understand their disobedience and plead with them to change. That's another option a truly loving father will take.

Theists don't have a way around anything, aliens are not God because aliens would also be born or created according to theists logic. Because you cooked a story up doesn't mean you have a way around logical criticisms. It only means you have blocked yourself from accepting an objective truth. And that's stupidity, sheer stupidity which is rapidly becoming the main feature of every theist.
Re: Atheism Is Foolishness? by Akin1212(m): 10:15pm On Feb 07, 2019
sino:
Of course you couldn’t refute the other points I raised which is actually backed up by further research, but rather hold on to amino-acids being ‘alive’ as an easy way out. Please tell me how the Urey-Miller experiment proves abiogenesis?! How did the supposed racemic amino-acids give rise to life?! No scratch that, what were the amino-acids produced and how did this experiment account for at least 50% of the amino-acids required to synthesize necessary proteins that are essential for life?!

Again how did the polymerization of these amino-acids happen?! These are part of the questions my ‘alive’ was referring to, but it doesn’t matter to you, if the experiment as well as further experiments cannot answer these questions and even more, then you are believer, having blind faith in science!
As much as this is laughable, once again you have succeeded in shooting yourself in the foot. And this time, you did exceptionally. Your desperation to establish that I have faith in science which is nothing but a laughable failed clapback has been noticed. But guess what, you're just making noise. grin

Anyone with knowledge in science will not find it difficult at all to see your obvious flaws littered in the jargon it took you two days to put together up there. But in the jargon, I will make bold your errors for you to see. It's left to you to see them.

- Just do yourself a favor and stop talking about science, amino acid don't give rise to life. Perhaps, you don't even know what life is, perhaps you think there's a particular thing called life in living things. I give up on your ignorance Sino.

- Amino acids are either D- amino or L-amino. But the ones found essential to life are L-amino, which were produced in the Urey-Miller experiment. This is however a plausible evidence that life through abiogenesis. But instead you believe that God breathe amino acids into humans, but can't prove it. Did God also breathe life into plants and other animals too? Explain to us or read to us from your trash book extensively how God gave life to living things, please.

sino:
The joke is on you Mr. Scientist, the research and researchers you are referring me to use the word design repeatedly through their research article, perhaps they were stupid to have used such a word?! You don’t get it, when you make use of structures to describe something, you are inadvertently acknowledging there is a design, a pattern, be it uniform or not (but this case uniform). These bonds are quite important for the functions of these macromolecules, and in the DNA, it isn’t just random bonding, but information-driven bonding which enables it to function optimally with respect to its replication and transcription. The bonds, the number of base pairs per turn, the form found in physiology are so unique and important that you can’t deny the intelligence! You ought to know about structures and functions na, but alas! Here we are… What the researchers have been able to do is study and learn from a naturally occurring DNA (genome), designed their own with the aid of a computer! If they say they design, who are you to question this?! And of course if they actually had to design one, common sense dictates that the naturally occurring one must have also been designed! Oh i forgot, common sense they say, isn't common!

Life happened no doubt, but my question is given similar billions of years, and with 26 alphabets to be randomly written, what would be the chances of writing a best-selling novel as well as other diverse meaningful story books, letters etc.?! Does it look plausible to you?! From the single unicellular organisms to the complex multicellular organisms, do you see any purposeless living organism?! How did this randomness ‘create’ such a working order using just 4 ‘alphabets’?! That is the big question your randomness and chance are yet to answer!
Lol, a scientist like you, or better a science critic like you who finds it difficult to criticize your faith is so obsessed with the word DESIGN because it so much fits and favors your narrative of a designer or a creator which you always hurriedly call your God or Allah. You see, it's not about a designer or anyone, just drop it and stop validating nonsense. They could use the word design in journals and they could also use code, they could as well use program, and the same way I can as well use DNAer or a builder. The only difference here is your particular choice and insistence in using the word designer which long last doesn't still prove anything. Please apply intellect, don't be a subject to your fantasies. Let's know what we're doing.

You are getting a wrong notion and use of the word random or its use, arent you? Perhaps you don't deeply understand Science to that point. Do you know that something can randomly be organized? Do you know that certain atoms will only bond to specific atoms at certain conditions and will continue to bond if the condition persists? The bonding in the DNA can be organized by chance depending on the conditions present prior to the bonding which is important for the structure of these molecules. And this bonding is also controlled by enzymes providing reactive active sites for them to happen. There's no inherent intelligence behind it, you have just made another bold claim. You have just once again filled the gap of knowledge by attributing the observation to an intelligence that cannot be proven. Why, ehn why? If these enzymes are removed, if these conditions are changed, the bonding will not take place at all, no matter what the intelligence you claimed has done. And these conditions are what we have termed the natural laws in science. So has your intelligent creator not failed if humans can alter his intelligence?

Lol, so common sense is that if they designed a genome by looking at the natural one, then the natural one too was designed? Lwkmd, you will never cease to amuse me. Okay then, let's apply your common sense. If the artificial genome which is observable was designed by observable beings, common sense should also tell us that the natural genome which is also observable too should be designed by an observable being. Now, where is the designer who designed the natural genome? Don't give excuses here Sino, just provide the designer instanta. grin. Let's see how common sense is so common to you, Mr intelligent.

Let me guess, you cannot! You must be a joke bro..... grin

Your question about alphabets is a result of your childish reasoning. You must have skipped logic classes in maths in secondary school, or perhaps you didn't do permutation and factorial in mathematics. However, I will try to help you think better bro, after all you have claimed that you are more intelligent than us.

Given billions of years, I don't know for sure if a novel can be written from 26 letters, but if the conditions that can incluence iit are available, it will be written fine fine, despite the fact that the analogy is stupid as usual. Billions of years is not 100 thousand years. Open your mind and learn. And this looks plausible than the useless claim or excuse that Allah did it, Allah did nothing!

The 4 letters in DNA code is just informative letters that tell us how nucleotide bases are arranged in the genome, and different arrangements of the codes has lead to 8.7 million trials and errors. By saying it gave rise to a working order is another nonsense from you. It has created order and also chaos. We have seen people who were born malformed because of the chaos this randomness can cause. Or do you think humans or other animals are perfect? You are really a joke bro. You know nothing!

sino:
You have just shown that you lack the understanding of the science in the research, but merely do follow-follow. So if I copy windows OS to write a code for my own OS, Did I create a new computer or a new OS?! Don’t you know the difference between Hardware and software ni?! You see, I omitted the reference for my quoted post for a reason, to weigh your understanding of what is being discussed here and not some propaganda believes about abiogenesis…. I will help you with quotes from the original research paper, the abstract and part of their discussion and conclusion, then you must show where I lied! Please take note of the word DESIGN!

DESIGN and synthesis of a minimal bacterial genome

Abstract

We used whole-genome DESIGN and complete chemical synthesis to minimize the 1079–kilobase pair synthetic genome of Mycoplasma mycoides JCVI-syn1.0. An initial DESIGN, based on collective knowledge of molecular biology combined with limited transposon mutagenesis data, failed to produce a viable cell. Improved transposon mutagenesis methods revealed a class of quasi-essential genes that are needed for robust growth, explaining the failure of our initial DESIGN. Three cycles of DESIGN, synthesis, and testing, with retention of quasi-essential genes, produced JCVI-syn3.0 (531 kilobase pairs, 473 genes), which has a genome smaller than that of any autonomously replicating cell found in nature. JCVI-syn3.0 retains almost all genes involved in the synthesis and processing of macromolecules. Unexpectedly, it also contains 149 genes with unknown biological functions. JCVI-syn3.0 is a versatile platform for investigating the core functions of life and for exploring whole-genome DESIGN.

So does this explain abiogenesis?! Let’s go further into the article....

"Genomics is moving from a descriptive phase, in which genomes are sequenced and analyzed, to a synthetic phase, in which whole genomes can be built by chemical synthesis. As the detailed genetic requirements for life are discovered, [b]it will become possible to design whole genomes from first principles, build them by chemical synthesis, and then bring them to life by installation into a receptive cellular environment. We have applied this whole-genome design and synthesis approach to the problem of minimizing a cellular genome."[/b]

The bold might be a little bit confusing, but I’ll explain, you see the synthetic genome is what is built from scratch, of course with the help of learning from the original design, and this did not form a life on its own as it would be shown later…

"In contrast, we set out to construct a minimal cellular genome in order to experimentally determine a core set of genes for an independently replicating cell. We designed a genome using genes from M. mycoides JCVI-syn1.0 (10). This mycoplasma cell has several advantages for this purpose. First, the mycoplasmas already have very small genomes. They have evolved from gram-positive bacteria with larger genomes by losing genes that are unnecessary in their niche as mammalian parasites. They are already far along an evolutionary pathway to a minimal genome, and consequently they are likely to have fewer functionally redundant genes than other bacteria. We also have a highly developed set of tools for building this genome and for assembling and manipulating the genome as an extra chromosome in yeast."

The first introduction of this synthetic genome to life can be seen here where it is placed and manipulated in a yeast cell….So what happens after?! Did this genome start functioning as a cell on its own to prove what Mr. Scientist wants us to believe about abiogenesis?!

What actually happened is the transplanting of the manipulated genome into an already existing bacterial cell.

"At each cycle, the genome is built as a centromeric plasmid in yeast, then tested by transplantation of the genome into an M. capricolum recipient." (See attached picture).

Source: Clyde A. Hutchison III et al.Design and synthesis of a minimal bacterial genome Science 351, (2016); DOI: 10.1126/science.aad6253

How does all the above different from what I posted, or how does it show that I lied Mr. Biochemist?!
Thank you for this. I suppose you omitted the source to cover your dishonesty once again. But to show you that before you even thought of misrepresenting the research once again,I have read the journal over and ober again. I will include my source and I will also highlight where you misrepresented in the journal. Aside from the fact thay you didn't specify your source which automatically disqualifes your jargon.

1. "They used whole genome design and chemical synthesis" specifies that chemical raw materials were used to make artificial or synthetic DNA which could carry out the same functions of a natural DNA inside a cell from scratch. What part of this is actually difficult for you to grab? This alone, proves that life can arise from chemicals or organic compounds which excellently explains abiogenesis.

2. Lol, you actually used your hand to bring a source, but the content of the source does not suit your narrative but you had to narrate it in a way that fits the Allah agenda. Let me explain the whole concept of life, genome and cells for you. Maybe, just maybe you'll wake up from your ignorance.

You see, living things are their genomes. The genome is the complete genetic information of an organism or a cell. The genome consists of coding genes(exons), non coding DNA(introns), the DNA inside the mitchondria and also inside the chloroplasts.

Now, life on earth is defined scientifically as a series of processes or metabolic reactions that give rise basically to the following biological functions. Movement or locomotion, Respiration, Nutrition, Irritability, Growth, Excretion, reproduction and death. This is basic integrated science. Right? And that's just on the basic level, but it also applies on all levels. In another explanation, biochemically precisely, anything that can perform anabolism and catabolism is alive.

Now, cells carry out the biological functions and they also carry out anabolism and catabolism, a cell is nothing but a compartment where these reactions take place.

The genome is the information bank for these biological functions and reactions. The genome is where the information of how these processes should be done is stored

So, if genomics is now moving from a descriptive phase to a synthetic phase where whole genomes can be built by chemical synthesis, it means we can build a whole genome from starting chemicals such as Carbon, Nitrogen, hydrogen and oxygen. This consequently means that we can build from ordinary chemicals the information required to sustain life or start life. This means that we can create life in its simplest form. Is it not easy to grasp?

Even if we learnt from the natural sequence and created our own sequence, does that mean we didn't create a synthetic life? Religious bigots have always asked scientists to create a life to convince them, now that it is done, they are coming up with excuses that it was copied from the natural one. Meanwhile, before, their bragging was that we can create things, but we can't give them life. This is becoming ridiculous lol.

The most important thing here is that, these scientists created a synthetic DNA, excavated the natural DNA without which the bacteria would be dead and incorporated the synthetic DNA which works just like the natural DNA. Is that the creation of life?

Their excuse now will be, why didn't you create a cell? cheesy

3. Your third flaw was also highlighted, its a shame you don't understand science, nor the research you're misrepresenting but you claim you do. Lol

A person who understands this research will not even ask if the genome started functioning as a cell. What kind of ignorance is this? In your quest to appear intelligent, you keep showing how unintelligent you are. This is another intellectual suicide. Can the DNA function as a cell? A cell without a DNA is dead. The artificial genome created was incorporated into

The following abstract says it all, the source is included in my own case. cheesy

Abstract
"We report the design, synthesis, and assembly of the 1.08–mega–base pair Mycoplasma mycoides JCVI-syn1.0 genome starting from digitized genome sequence information and its transplantation into a M. capricolum recipient cell to create new M. mycoides cells that are controlled only by the synthetic chromosome. The only DNA in the cells is the designed synthetic DNA sequence, including “watermark” sequences and other designed gene deletions and polymorphisms, and mutations acquired during the building process. The new cells have expected phenotypic properties and are capable of continuous self-replication."

From the research article, if Sino by chance knows anything about molecular biology, he would know why the genome was inserted into yeast cells. But I guess I'll have to help him again, read below from the source.

"We developed a strategy for assembling viral-sized pieces to produce large DNA molecules that enabled us to assemble a synthetic M. genitalium genome in four stages from chemically synthesized DNA cassettes averaging about 6 kb in size. This was accomplished through a combination of in vitro enzymatic methods and in vivo recombination in Saccharomyces cerevisiae. The whole synthetic genome [582,970 base pairs (bp)] was stably grown as a yeast centromeric plasmid (YCp) (7)."


It is obvious that the genome was assembled by enzymatic process and by recombination process in yeast. Sino wouldn't understand that, would he? I will not respond further, here is the link to the source, the link which Sino refused to post because of his dishonesty. Biochemistry is very simple.

http://science.sciencemag.org/content/329/5987/52.full
1 2 3 4 5 6 7 Reply

Patience Is Not Foolishness. It’s Strength!Saudi Arabia Calls Atheism And Feminism Extremism Then Apologises For FeminismWhy Is Islam Afraid Of Atheism (and Apostasy)?234

Time To Stop Eating Sahur?Why Protesting Or Rebelling Against The Ruler Is Not Always The Solution?10 Facts About UD'HIYAH (ileya Sacrifice)