₦airaland Forum

Taymiexo:
What app did you use to edit these. I find it hard to believe you used a Tecno Pop1 to take these shots cuz these are � bruh!

thanks man.
i took those shots on HDR mode
and finally did some minor tweaks using "Google Photo" app.

it's just easy, if you know your way around it.

SEGLIZ:
enter the cruise.

baba na cruise oh, las las

SEGLIZ:
aiye don't clock.

.

GioneeOnline:
gionee P12 is nigerian model of gionee phones and its pocket friendly accesaries available as at when due so you are good to go

thanks, man. will do

Devynecheeh:
Pls what app did you use for the editing??

just a few tweaks, using the Google "Photos" App

Devynecheeh:
Hi...I just got the phone last week from slot and trust me it's good for the price.. even tho the battery is just 3200mah.. I charge twice a day only when am on it throughout... and the price is #38,900 from slot

thanks alot bruv, will definitely give it a go.
pray i find one here in Mararaba

Jonny2wealth:
. Were u able to get the phone in abj? If yes how did u get it? Am in abuja and need one too

not yet bruv

Good day guys.

i came across the Gionee P12, which should cost around 32k-35k, I've been searching for entry-level phones - with atleast 2GB ram - to purchase before now.

please, I'd like to know how efficient or average this smartphone (Gionee P12) is.

your inputs are highly appreciated.

alleazardous:
Did you just say boring?? Chess is addictive

ever so true

MacZrino:
Abuja

where in abuja? you on WhatsApp??

MacZrino:
35k

location, bruv?

ecomm:

rand_dna = "CCTGTATGCCCAAGGGGTTTCGATCGTACGACTGTCAGTCAGCTAGCT"

dna = {'C': [], 'T': [], 'A': []}

 for letter in rand_dna:
 if letter == 'C':
    dna['C'].append('C')
 

wow! and this right here, is the beauty of coding with Python

peacettw:
Never mind, I have figured it out
dna = "CCTGTATGCCCAAGGGGTTTCGATCGTACGACTGTCAGTCAGCTAGCT"
l=list() n= len(dna)/3 count=0
print(dna, "\n" ) while n>0: j=dna[count:count+3] count = count + 3 n= n - 1 l.append(j) print(j) print(l)

this is great, dear. guess i really have to return to python soon as possible.

Tarvel:
Why am I getting this error?

try converting your received input to a string datatype, using the 'str()' function.

Macro Shots

Redpanter:
Best price:

Umidigi A7s -
#35900

Umigidi A9 Pro 6gb 128gb -
#71900

Umidigi Uwatch 3S -
#16900

Umidigi Urun -
#19900

Pay on delivery
Fast Express delivery

Contact on WhatsApp: click here or call 2348127838587 to order

you reside in abuja??

Good day guys,

I'd like to know if i can purchase an Umidigi device; Umidigi A7s precisely, from a store here in abuja.

heard about Banex Plaza, but not sure if i can get one there.

¶Stëllår

Organsmuggler:

but, you don't gat prove for this

The legality of incest varies from country to country.

In some countries, incest is punishable by the death penalty, such as in Brunei, Iran, Nigeria, Saudi Arabia, Somalia, the United Arab Emirates, and Sudan (if same-sex relations). In Afghanistan, incest between consenting adults results in the death penalty in Taliban-controlled territories.

In Italy, incest is only illegal if it provokes public scandal. In this case, it can be punishable from two to eight years in jail.

Twenty-two countries around the world have not criminalized incest.
In Spain and Russia, consensual incest is fully legal; however, people who are related as siblings, half-siblings, a stepparent, and a stepchild may not marry.

Incest is also not strictly prohibited under Portuguese law. Additionally, no laws prohibit consenting relatives from having sexual relations in France, Belgium, and Luxembourg. The people of the Netherlands are allowed to engage in incest as well but cannot get married.

In Greece, incest is illegal for adults, but there is no law prohibiting minors from engaging in incest.

In Serbia, Slovenia, and Lithuania, incest is illegal as long as both persons are over 18. In Serbia and Slovenia, incest is illegal if one or both of the person is an underage relative by blood or an underage sibling.

In Israel, incest is legal if both persons are over 21 years old. It is illegal if one or both of the persons is an underage relative by blood or adoption. Incest is also legal in Argentina, Brazil, India, the Ivory Coast, Japan, Latvia, South Korea, Thailand, and Turkey.


¶Stëllår

SamuelLoch:
The cost of shipping is on the page where you viewed the phone. It could be free or for a token.

oh, gotta do some recheck then.

but, thank you still.

SamuelLoch:
Some items are cheaper to purchase on Aliexpress but lately delivery has been the issue. I am still expecting some items since November last year. According to the tracker, it has not left their country since, for whatever reasons.

So, if you can exercise patience, use Aliexpress.

oh wow!

but how's the fee like?
if I should place an order for that umidigi A7s which sells for N30,650; what would be the cost for shipping??
and how much would be charged in total??

hey guys, i saw this on Aliexpress, this morning; don't know how true this is.

Michael390:
you sound like a really nice Gentle man for that I'll respect your post and I'll kindly advice you to increase your budget a little bit and buy the VIVO Y1s 32GB, 2GB at 39 thousand you can get it at any phone shop like SLOT.here's a link :-
https://slot.ng/product/vivo-y1s-32gb-2gb/

Thank you so much, man.
I really appreciate.

SamuelLoch:
Hi Stellar360, yes, you can get a smartphone for N35k but it might not serve to be the best product.
With that budget, you can get a new Tecno, Umidigi, or Infinix with 2GB RAM and about 32GB storage. The camera might not be as good as your 'eyes', but you would still be able to capture moments.
You can check Jumia for a list of phones

yeah, i am quite aware.
Thing is, i could use some suggestions, honestly; especially on what brand or device. like, say spark4, Umidigi A3s, e.t.c

Lexusgs430:
Umidigi A7s, via jumia......

i assume it'll cost more than that, after including the delivery fee

Good afternoon guys,

I'm looking to purchase a smartphone, and my budget is 35k.

My favorite brands are Umidigi, Redmi and Tecno (albeit, i am quite aware that REDMIs are more expensive, and therefore exceeds my budget)

any suggestions as to what smartphone I should go for, would be HIGHLY appreciated.

Lexusgs430
atheistandproud

��

maclawrence02:
The blues are a bit too much and oversaturated. I was guilty of this when I first started, now I'm adjusting. See if you can tone down a little.

Sure will.
Thanks for the Tip.

morning guys. I live in Abuja, and I can't find any store that has Umidigi A3s. please, i would appreciate some help thanks

morning sky