Please is there anyone here or any programming group.. python or html and css or Java
Kindly aed this no 07066572839 thanks

Mac2016:

I'm interested.

I am also interested
07066572839

Hello everyone!

I have created a python group where those interested in learning python can get tutored.

Strictly whatsapp based and it's free.

For those that would like to teach in the group should send me a PM.

For those that are interested in learning, kindly drop your number so that you can be added.

Yours Sincerely
Lambda.

07066572839
Please do add me

Please is there any WhatsApp group for html and css guys

Thanks nairaland for wishing well on my day.
Wish me good things in life, guys
And don't forget to send me stuffs also
2270175639
Zenith

Big shit

Seniorwriter:


Lolz how do you know you are a good player
..what's your rating?
Reach me on facebook ...my FB ID is on my profile

Proactivity Leads To Productivity !!!
@Seniorwriter

I just sent a friend request to you now... I saw only two accounts that bear your name I sent to the one with Barça pp

Seniorwriter:


Lolz how do you know you are a good player
..what's your rating?
Reach me on facebook ...my FB ID is on my profile

Proactivity Leads To Productivity !!!
@Seniorwriter

ok I will surely reach out to you right now sir
I am not that good lol But I am still above average and still learning

My rating is around 1800 (classical) I also play blitz and rapid

Seniorwriter:
Make small Bucks playing the game of strategy (CHESS) online.....
I've come to realize how factual the saying TIME is MONEY is....so I can't afford to have a spare time devoid of earning.

Deep Quote:
Time is Money and a waste of Time in any form is equal to waste of MONEY!!!

Proactivity Leads To Productivity!!!
@Seniorwriter

please how can I make money playing chess online
I am a good chess player

Tajbol4splend:
Go and be playing pes league with super star level, nothing is more interesting

send your pes ID boss lemme show you what's more interesting than playing with super star level

Girl9999:


I never told him no sex until marriage. I told him about my experience in University and we both agreed to have sex when I was ready; when I was emotionally prepared. We are just two months into the relationship.

why you come dey date when you not ready for sex and wahala
Some of you self

denvers:

String way = "where are you going exactly?";
System.out.print(way);

java script

Lol nothing happens when you don't work for it
Masturbation is not the cause of your problem, you're

ensodev:


Presently I don't have a running programing whatapp group and I don't plan one in future.

Email me I can tell you what to do

I have email you sir

extol1:

did they force you to donate the money by all means or was a gun pointed at you to bring the money? all these nonsense must stop, trying to paint the Church as a business venture. you gave at will and here you come online telling us how you use your 5k.
please be careful fa

your church is a business..
Ask your pastor

ensodev:
5-You have to be a good researcher before you could be a good programmer. Remember i said the major activities of programmers is solving problems. If you could not dig deep on the solution you might never get the solution.
Am happy to tell you that most of the problems you will will be facing in coding as a beginner has been faced before and the solution is on a server somewhere on the internet..in some books somewhere, in a library, a pdf file or even a blog or forum like this.
If you can search for it, brethern you can find it and if you find it than you can solve it.
This leads to my next point
6-Dont ever ask any programmer what you have not ask GOOGLE.
You think its funny, NO it not, lots of programmers are ready to assist you but first we want to know how far you've helped youself.
The reason most people dont get feed back from most professional programmers is that what they are asking for is just right infront of them. Is not as if some beginers are blind to see or deaf to not have heard about GOOGLE SEARCH, YAHOO SERACH.

If you realy need professional programmers to respect you and respond to you fast..let them see how far you gone to solve that problem in your code and in your search.
Most of the solution are on stackoverflow, goolge and w3shool, and Documentations. Why dont you search it out first, if you couldn't get solution to your problem. Then ask prof programmers showing your code..composely stating what the problem is and placing links of some solution you've seen online but did not 100% solve your problem.

pleass I want to join your group on whatsapp how do I do that

uwemneku:
Hi, I'm learning java and as much as I find it interesting, I know for a fact that I'll learn better and faster if I was part of a group. Thanks to technology, that's possible. The Whatsapp group will be a focused one, textbooks will be selected and schedules created. We'll also have discussion sessions and see how we can combine our individual research on different topics.

The focus at first will be Java but we can add other languages later. Kindly pm me or drop your number if interested.

Thanks.

07066572839

uwemneku:
Hi, I'm learning java and as much as I find it interesting, I know for a fact that I'll learn better and faster if I was part of a group. Thanks to technology, that's possible. The Whatsapp group will be a focused one, textbooks will be selected and schedules created. We'll also have discussion sessions and see how we can combine our individual research on different topics.MI

The focus at first will be Java but we can add other languages later. Kindly pm me or drop your number if interested.

Thanks.

I am on my way to learn Java also I am almost done with python

Well if you're on python group also you can do me a favor by6adding me

tsdarkside:


i tell you bros....
it would be painful to use years to program something and some people crack it in days....

thats why i didnt went further....

lol cos at first, you're not interested in it. You only wanted to learn it for learning sake.
Well, there are still some apps that can't be cracked... So this is just an excuse to me

progeek37:
CONSIDER JOINING MY TUTORIAL GROUP

Anyone can use frameworks and libraries to develop softwares and applications. There seems to be frameworks and libraries for many applications, this has shifted the attention of some people from understanding the core principles of softwares engineering... algorithms and data structures. There are many frameworks and libraries for virtually anything we want to do, but can they meet all our needs? No, not at all. You would like to program how your software should work the way you want it to work. Then learn to program first. At a professional level what distinguishes one programmer from the others is the knowledge of algorithms and data structures. No matter what you may think this is an absolute truth!

Software companies are riddled with a shocking amount of self-taught amateurs who, despite having programmed on a salary for years, have no grasp of the fundamentals of programming and have no idea what a hash table is, how polymorphism works and how to work with bitwise operations. Don’t be like them! Learn the basics of programming first and then the technologies. Otherwise you risk having your programming skills crippled, more or less, for years, if not for life.
To join the group send me a private message and note I'm not promising to teach you web, mobile or desktop development and as well I'm not promising to make you to be a professional programmer, no not all, and no one person or book or tutorial can do that. To become a proffesional programmer you will have to work hard for some years, years of active and committed programming and project building. My tutorial will certainly pave a way for this journey!
What do I promise?
I'm going to teach you how to program, how divide programming problems into steps and tackle them without fear or visiting the internet. This is the most important thing you need, the rest will become easier if grab these fundamentals

As improbable as it might seem to you, the basic principles of writing computer programs have not changed all that much in the past 15 years. Programming languages change, technologies get modernized, integrated development environments get more and more advanced but the fundamental principles of programming remain the same. When beginners learn to think algorithmically, and then learn to divide a problem instinctively into a series of steps to solve it, as well as when they learn to select the appropriate data structures and write high-quality programming code that is when they become programmers. Once you acquire these skills, you can easily learn new languages and various technologies – like Web programming, HTML5 and JavaScript, mobile development, databases and SQL, XML, REST, ASP.NET, Java EE, Python, Ruby and hundreds more. If you’ve never written a computer program, don’t worry. There is always a first time.
In this tutorial I will teach you how to program from scratch. I do not expect any previous knowledge or abilities. All you need is some basic computer literacy and a desire to take up programming. The rest you will learn from the tutorial.
If you can already write simple programs or if you have studied programming at school or in college, or you’ve coded with friends, do not assume you know everything! Join the group there might be many things you are missing out along the way.

As the world has moved to digital era, where artificial intelligence can take control of the affairs of the world. There is a need to train
programmers who will be the driving forces. Nigerians should not be left behind in this matter, we need experienced programmers who can bring innovations to our country.
Some people keep asking how do I learn programming and what is the best programming language to start with. I have a simple answer to this question:
Start by learning the fundamentals of programming itself and how algorithms work. The programming language to use is really irrelevant at the moment, and no programming language is better than the others, every programming language was developed to meet urgent needs and was created for a particular purpose. Every language has its own advantages and every single one of them could solve most of the problems you'll face in software development process. You should choose the language that you're familiar with. Great softwares are made by great programmers, not by languages they use. So stop wasting your time jumping from one search engine to another to find out the best and lucrative programmming language. I repeat, you can start from any programming language. You must be determined if you really want to learn programming, don't give up easily. Some people have given up before they reach the rewarding apex of programming career. You should love coding, you should love solving problems. Don't love money! Love coding instead. If you love money you may give up before reaching a point where you will start receiving the money. Programming is a lifetime commitment, are you prepared to take it up? I repeat there is no end in coding. You will code until you grow gray hair and die. Are you willing to sacrifice that much time? Programmers are really the most current professionals. they adapt to new technologies like chameleon. If you are determined let's start now! If you have a tendency to give up at a slight encounter of difficult syntax then I would rather recommend a programming language that has simpler approach to syntax, such languages include Python, Java, C#, Ruby and Javascript. I strongly recommend Java. Starting with C or C++ may discourage some who are new to programming because of C strong use of syntax, to be able to solve a simple problem in C, you need to write many lines of code and follow many rules, the beginners who are not determined to learn programming may easily be discouraged. However, if you are determined, not even C can deter you from learning coding.
Resist the temptation to start programming by designing and developing websites and mobile apps, you can never be successful if go on like that. If you start programming like that, you will end up being a laughing stock in a software company. I repeat, don't start programming with building website applications and app development, those things are not bad but you need to start them when you have understood how algorithms work. What is algorithm?

A sequence of steps to achieve, complete some work or obtain some result is called an algorithm. This is how programming is related to algorithms. Programming involves describing what you want the computer to do by a sequence of steps, by algorithms.

Some of your colleagues directly begin programming with Web or mobile applications and databases without knowing what an array, a list or hash table is. Do not envy them! They have set out to do it the hard way, backwards. They will learn to make low-quality websites with PHP and MySQL, but they will find it infinitely difficult to become real professionals. You, too, will learn web technologies and databases, but before you take them up, learn how to program! This is much more important. Learning one technology or another is very easy once you know the basics, when you can think algorithmically and you know how to tackle programming problems.

Starting to program with web applications or/and databases is just as incorrect as studying up a foreign language from some classical novel rather than from the alphabet and a textbook for beginners. It is not impossible, but if you lack
the basics, it is much more difficult. It is highly-probable that you would end up lacking vital fundamental knowledge and being the laughing-stock of your colleagues/peers

Reading books without practising is meaningless! You must spend much more time on writing programs than reading the text itself. It is just like learning to drive: no one can learn driving by reading books. To learn driving, you need to drive many times in different situations, roads, cars, etc. To learn programming, you need to program! Everybody has studied maths in school and knows that learning how to solve maths problems requires lots of practice. No matter how much they watch and listen to their teachers, without actually sitting down and solving problems, they won’t learn. The same goes for programming. You need lots of practice. You need to write a lot, to solve problems, to experiment, to endeavour in and to struggle with problems, to make mistakes and correct
them, to try and fail, to try anew and experience the moments when things finally work out. You need lots and lots of practice. This is the only way you will make progress. So people say that to become a developer you might need to write at least 50,000 – 100,000 lines of code, but the correct number can vary a lot. Some people are fast learners or just have problem-solving experience. Others may need more practice, but in all cases practising programming is very important! You need to solve problems and to write code to become a developer. There is no other way!

I have created a WhatsApp tutorial group to be run using the Zoom app which allows sharing of computer screens, you can send me a WhatsApp message if you need the tutorial. Please note is the tutorial is available in Java and Python now.For details send me a WhatsApp message.

please is this group still available here is my number 07066572839

Lol, normal stuff
You can't expect the government of Oyo State to back him up publicly

If Seyi does that he will be a target for all these herdsmen leader...
When dealing with all buhari and the other cattle rearers you just have to play smart

mbhs139:


It's been a long time since I posted it, and it has a time frame. I think it was actually active during the heat of the first lock down in Ontario

ooooh! But, please is there another way to get all those stuffs?

mbhs139:
TOP 7 Books for python developers to read must in 2020
Share this message with other python developers or python
learners to grow python community

Learn to Program with Python
https://www.bookelf.in/book/467/pt

Python Unit Test Automation.
https://www.bookelf.in/book/522/pt

Expert Python Programming
https://www.bookelf.in/book/513/pt

Hands-On Machine Learning with Scikit-Learn and TensorFlow
https://www.bookelf.in/book/474/pt

Machine Learning with python
https://www.bookelf.in/book/473/pt

Mastering Natural Language Processing with Python
https://www.bookelf.in/book/470/pt

An Introduction to Statistics with Python
https://www.bookelf.in/book/458/pt

https://www.tutorialbar.com/python-for-data-science-and-data-analysis-masterclass-2020/

https://www.tutorialbar.com/complete-python-bootcamp-2020-with-practical-projects/

https://www.tutorialbar.com/python-for-beginners-anyone-can-code/

https://www.tutorialbar.com/neural-networks-in-python-deep-learning-for-beginners/

https://www.tutorialbar.com/software-development-in-python-a-practical-approach/

https://www.tutorialbar.com/the-self-taught-programmer/

https://www.tutorialbar.com/step-by-step-guide-to-machine-learning/

https://www.tutorialbar.com/time-series-analysis-and-forecasting-using-python/

https://www.tutorialbar.com/the-complete-python-3-course-beginner-to-advanced/

Introduction to Machine Learning with Python

AUTHOR:- ANDREAS C. MUELLER AND SARAH GUIDO

Download Book Now����

http://dynamicduniya.com/bookdetails?id=68/introduction-to-machine-learning-with-python


A beginner-friendly list of data science projects


1) Rainfall in India

Project type: Visualization
Link to dataset : https://www.kaggle.com/rajanand/rainfall-in-india

2) Global Suicide Rates

Project type: Exploratory Data Analysis
Link to dataset : https://www.kaggle.com/russellyates88/suicide-rates-overview-1985-to-2016

3) Summer Olympic Medals

Project type: Exploratory Data Analysis
Link to dataset : https://www.kaggle.com/divyansh22/summer-olympics-medals

4) World Happiness Report

Project type: Exploratory Data Analysis
Link to dataset : https://www.kaggle.com/unsdsn/world-happiness

5) Pollution in the United States

Project type: Visualization
Link to dataset : https://www.kaggle.com/sogun3/uspollution

6) Nutrition Facts for McDonald’s Menu

Project type: Exploratory Data Analysis
Link to dataset : https://www.kaggle.com/mcdonalds/nutrition-facts

7) Red Wine Quality

Project type: Prediction Modeling
Link to dataset : https://www.kaggle.com/uciml/red-wine-quality-cortez-et-al-2009

boss, that bookelf is not working anymore

Tbadbad:
Hello everyone, ‘my story is long but I will skip some to try to make it short, sorry for my grammatical error, I am not a writer and I am writing with pains and I might made some mistakes, please bear with me.

I have been dating my wife to be since 2017, I have been taking care of her and everything, the truth is I was hearing some funny stuff about her since I met her but I didn’t take it serious because I trusted her and I really thought she was decent from every other girls.

When I met her, she told me she had only dated 3 boys for have sex only three times, her first boyfriend and two other girls she met in school. I really believed her because she was acting decent.

At a point I began to suspect her when I started hearing some stuff about her but I didn’t pay attention because I trusted her, sometimes when I asked her if she ever dated some one else or cheating on me, she will just turn the whole thing to quarrel and I will just lock up.

Fast forward to 2020, I got her pregnant before I left Nigeria, we did introductions, but she lost the baby during child birth which was so painful to us, but after some month I begin to hear some news about her, and I confronted her and threatened her that I have proof, which she confess to me that she has dated about 3 boys, slept with them several times, she also bleeped 2 girls just once and they didn’t date, she just had crush on them and bleeped them before she met me, and she cheated on me when she found out I was chatting with my ex’s, she couldn’t bear the pains even after begging her, sex her and still give her money to school, the same week she met a guy and bleeped him because she wanted to ease her pains, and 2019 when we had little quarrel, she met a guy and bleeped twice because she thought we broke up (what happened was that we had little argument and I have her money to sch and we didn’t talk for a week, that week she met a guy and stayed dated him because she thought we broke up).

I was heart broken when she told me, and I wanted to brk up, her parents begged me and they never supported her and they were even surprised she could do such thing because she came from a very decent background. I forgave her but I still have the pains in my heart, we always chat everyday, because of corona things are some how and I don’t have money like before, she begins to show me some attitude which is not really comfortable and I explain things to her and she apologized.

So last month she told me since I left she have been having sexual urge to sleep with a girl because she have been watching lesbian porn, that she promised never to cheat on me with a man and it’s taboo but she wanted to have sex with a female, I was so shocked and didn’t know what to do. She said she just started having the strange feelings because she have been watching lesbian porn since I left, I feel like I don’t know anything about her, I wanted to brk up now because she is begging me and she is saying she is just trying to be truthful to me because she promised herself never to hide anything from me or lie to me. What should I do? Should I continue to be with her and marry her? Or run away? Mine she have never slept with a woman before and she has always hated lesbian but because I have been a way since feb 2020, she usually watch porn to help herself. Pls what should I do?

which kind idiot you dey date self...
She knows no other thing apart from sex.. Why wtf??
This girl won't add anthing to your life dump her!!

I thought it's about ASUU

Stuck here please help


Using OOP, design a GPA Calculator.

The names, levels, departments, and courses offered by the students should be accepted.

Assumptions: All students offer at least 7 courses.

Create a method to display the last name of the students and their GPA

Create a method which compares the GPA of student with another student and notify the student with the higher GPA indicating the full name of this student and the GPA

peacettw:


I understand. It can be quite tricky.. Take for instance my challenge. All I wanted was how to convert the contents of a list back to a string. Never knew that a string had a join() method until now.

Need to study more

yeah that's where I am driving at
Just ' '.join() will do it easily
I just started programming also

syluck:
This is my problem. I hope this doesn't get deleted.

I've been trying to run some codes using while loop on python. At the end of every false trying to make it true, it keeps running the false even after I might given the command when it's true.

Below is a screenshot

add break or pass after

peacettw:
Never mind, I have figured it out

dna = "CCTGTATGCCCAAGGGGTTTCGATCGTACGACTGTCAGTCAGCTAGCT"

l=list()
n= len(dna)/3
count=0

print(dna, "\n" )
while n>0:
j=dna[count:count+3]
count = count + 3
n= n - 1
l.append(j)
print(j)
print(l)

you can actually use another method for this... I am not familiar with this your method very well

yusman14:
Yes I am in support of creating a WhatsApp group for beginners...you can create the group and we will drop our numbers..

yeah if you guys want it.. You can drop your numbers here then I will add you to the group

I want to do same