kelvinrhs:


Earlier this year (February precisely) I sold my 86 Doge and my zen coin for #2k or thereabout


I don't think 2k can buy 20 Doge today

Life goes on...


ALL DIE NA DIE!!!

ugo41babe:

Done

ugo41babe:

Ok

ugo41babe:


0x5f514D3F6eDf61f7c233D37E16211441C6a0536f

Thank you so much

ugo41babe:


Pls can some one help. I need 1usd worth of smartchain token. I can pay in naira pls.

Tablechair:
or the person should just send him the money via world remit.......

fredwill1357:
House What is the best and cheap way to receive a little money from India to Nigeria? About 50 dollars.

Cooldiipo:
Available and ready to serve!

SuperKlean:
please can I pm you too? I need help also as I'm interested in data analysis. I just started python but I need someone to put me through, thanks.

noob03saibot:
Nice thread. Really informative. Would want to ask, please got any idea why pca is used? And how can one make meaning / interpretations from it? Reason why I ask is, why is it useful since I can't seem to interpret it by seeing which Cluster of people belong to which group unlike before pca is performed on the dataset.

Kingray10:
I want to learn data analysis, please can you guide me through
I don't know where to start with.
It's kind of broad...

Mrves111:
I want to perform multiple image processing using opencv in jupyter notebook. I tried to upload the datasets (images) that's stored in my desktop using this code:

import os
import numpy as np
import cv2

img = cv2.imread('/User/victor/Desktop/data/mask/facemask.jpg', 0)
img



import os
import numpy as np
import cv2

resize_width = 100
resize_height = 100
path = '/User/victor/Desktop/data/mask/facemask
images = [] # List to append the images as 2D numpy arrays.
target = [] # List to append the target
originalrepo = [] # Create a repo for flattened pixels

for root, dirs, files in os.walk(path):
for file in files:
with open(os.path.join(root, file), "r" as auto:
img = cv2.imread(root+'/'+file, 0)
img = cv2.resize(img, (resize_width, resize_height))
images.append(img)
# Append the flattened image to the pixel repo
originalrepo.append(img.flatten())
# Append the folder where the image is to the target list
target.append(root.replace(path,'').replace('/',''))
# Convert the repo list into numpy array
originalrepo = np.array(originalrepo)
print(originalrepo)
print(target)

I got this error :"opencv(4.5.1)/private/var/folders/nz/vv4_9tw56nv9kvyaszvwg80000gn/T/pip-req-build-39p1qqfs/opencv/modules/imgproc/src/resize.cpp:4051: error: (-215:Assertion failed) !seize. Empty() in function 'resize'

Please I'm appealing for assistance, if there's another simpler code I could use or if I made any error.
Note that I opened the jupyter notebook in the same folder that the dataset are located.

peacettw:


Ok. Thanks for the tips and I am female.. May I know where to access the code formatting tool?

peacettw:
Never mind, I have figured it out

dna = "CCTGTATGCCCAAGGGGTTTCGATCGTACGACTGTCAGTCAGCTAGCT"

l=list()
n= len(dna)/3
count=0

print(dna, "\n" )
while n>0:
j=dna[count:count+3]
count = count + 3
n= n - 1
l.append(j)
print(j)
print(l)

import statistics # for calculating our mean, median and mode

def calc_measure():
    # Let's create a random list
    num_list = [4,2,1,9,3,6,4]
    
    # we can calculate the measures here    
    mean = statistics.mean(num_list)
    median = statistics.median(num_list)
    mode = statistics.mode(num_list)
    
    print(num_list)
    print(f"The mean is {mean}"
    print(f"The median is {median}"
    print(f"The mode is {mode}"
    
calc_measure()

oyolohi:
I got interested in the matter of mods shutting down this page or not:

While I don't think that would happen soon, I've chosen to act while having fun.

I've coded a script and scraped this thread: all 147 pages of it (as at this afternoon).

The whole data has been stored on my SSD in JSON format. I'll be releasing the code after cleaning it up.

Here's the format for now:

{
    page_number: {
        post_number: {
            author: str,
            text: str,
            likes: int,
            shares: int,
            date: str,
        },
    },
}

With the JSON data (accessible by all), one could do interesting things like sorting posts made by particular users, most liked, shared, etc.

The version 2 of the script will store images and memes so nothing will be lost; might drop it on github when I'm done.

It's lots of interesting things to do with data from this page, -- with little AI and Language Processing, I will separate the posts into:
1. Questions (and answers to those questions)
2. Experiences (and users opinions)
3. Philosophies
...

Lots of interesting things to do with this page right now... you guys should stay tuned. 21cents and co, don't worry, we've got your back.

P.S. : Martinez39s, you didn't think of this? I want to believe you already have some pages of NL "programmatically" stored OFFLINE

Harkstetunz:
Hello Programlanders .
I've been learning python for some time using 'Automate the boring stuff' ; I've been scaling through each topic successfully, not until I got to chapter 8 project where the knowledge of command line argument is to be employed in multiclipboard project.
The problem is I don't seems to understand handling command line arguments, as much was not written about it in the book. I've watched some YouTube videos but it's the same old story.
I'm using pycharm text editors.
len(sys.argv)==3 and sys.argv[1].lower()=='save':
for my program to work, the above condition must be true but my len(sys.argv) is always 1 thereby rendering my code useless.
I will really appreciate it if you can help me out or better still recommend any book that comprehensively explains HANDLING COMMAND LINE ARGUMENTS in python



Evilsec
Ibromodzi
Stanliwise

len(sys.argv)

sys.argv

obiscolly:
Hello all,
I'm looking for people interested in joining a study group with a focus on AI and Data Science specifically relating to Nigeria. I started exploring this field a while ago, and while I don't consider myself an expert yet, I feel it would be beneficial to connect with like minds in the field and build a little community to help each other out and potentially build solutions to country-specific problems. I feel the world is moving in this direction and Nigeria must not be left behind in the transformation.

This group will focus on answering questions and collaborating on projects involving topics like machine learning, deep learning, data visualization, etc. If you are an expert in this field already, your contribution will be very much welcome, and if you aren't yet like myself, or are just a complete novice in the area, the chat rooms will be always open for questions.

I hope the mods can allow this post as I am not advertising. Simply looking to collaborate with like minds. If interested, please join the Discord group using the link below. I thought Discord app would be a great platform because of the ease of sharing codes.

https://discord./fkdBEjae

olamidedivotee:


Okay sir thank you very much

olamidedivotee:

Sir, please do u live in Lagos?
Please drop your number. i need ai learning materials.

Datst136:

Sir i sent you a dm, I require your aid in regards to Data science

Predstan:
This really is the best thread to go from. Read few pages and get some heads on into the process

https://www.nairaland.com/5233208/general-usa-student-visa-enquiries-part/716#5233208.22912

Predstan:


I’m on a full funding scholarship and my responsibility is to teach undergraduate courses. America is flexible, you can major in anything and minor in computer science. I’m still in the engineering field and minor in computer with concentration on artificial intelligence.