₦airaland Forum

sino:
It seems until you write a whole lot, you wouldn't convince yourself that you have made a point?! All the story story you have written doesn't show that my statement was wrong in anyway. The example of E-coli with about 4.6 X 10⁶ bp was given in Leghninger, and that error occurs only ONCE per 1000 - 10,000 replications! if this is your own definition of prone to error, then you need to examine your brain! Again, Leghninger used VERY ACCURATE to describe the replication process, but olodo like you is arguing this, and explaining erroneously what had already been clarified in the textbook! For your information, the repair process also gives the replication of the DNA that level of accurateness in order to maintain genetic integrity! Again, I stated clearly that such errors are repaired through a process of checks and repairs that follow a guided rule. Even if the repair process is after replication, it is still part of the process of maintaining genomic integrity!. This is breaking it down for all to understand and not going about writing epistles that is just exposing your inadequacies and insecurities! You really need comprehension lessons!

Lol, I can relate to how you feel right now. In the first tripe you made, you said DNA replication is very accurate. When I objected you came back and started rewriting your mistake by saying the errors due to replication are repaired. Aren't you silly by going back on your words? If replication is accurate, would it be repaired? . Your headline point was wrong, had you read through the explanation, you wouldn't have said that nonsense. Replication is distinct from repair. Repairs save replication from errors. Hence replication is error prone, even if it is one out of 100000000. Error is error. Bobrisky is ugly, but with make up he is beautiful. Does that change the fact that bobrisky is ugly? NO! Replication is error prone, but with repair replication is made to be nearly accurate. Does that change the fact that replication is error prone? NO

These things are simple, but you're unintelligent enough to grasp them. I have really tried for you. The bolded actually reveals how dishonest you are, even if the repair is after replication, lol. Shame unto you Sino. . Empty head!

sino:
You know next to nothing about abiogenesis, even your understanding of biochemistry is suspect, no wonder you are just dogmatic about your belief in science. Since you believe that life doesn't need intelligence and that abiogenesis is true, answer these questions:

Did Venter and his team depended on life to make their synthetic genome?! And can the synthetic genome function without a living cell?! Would you say Venter and his team were not intelligent?! And given their intelligence and advanced tools, still, they had difficulties in making a synthetic genome on their own, how then was it possible for life to have begun on primitive earth without all these intelligence and sophisticated machineries at the disposal of Venter and his team?!

Remember, the thread is about exposing your foolishness, and by the way, you are doing a great job!

Lol, I have successfully taught you lots of biochemistry with this back and forth, even though you don't want to accept that, it's alright. I am not arguing anymore about Craig Venter research, even lehninger claimed the research was a breakthrough to creating life from inanimate chemicals. So why would I even take a pseudoscientist serious. I have studied biochemistry and graduated and still studying it. If a random scientific rogue like you think I don't know it on Nairaland, what does it change? I have always screenshotted clearly stated explanation to buttress my points. I see how you accepted being schooled on the organization of life, yet I know nothing. I agree, I know nothing but when it comes to you and biochemistry, I am many steps agead of the likes of you. .

Theres is nothing like intelligent design in science, it has already being established. Embrace science and drop your fantasies. And stop asking questions, I have answered like a million already. Answer the ones I asked. Give us a plausible, hypothetical mechanism of how life began aside abiogenesis. Tell us how Allah the intelligence was able to create errors.

sino:
I just saw that you presented a dictionary meaning for accurate, funny you jumped the first meaning which is precise, to state that it means perfect, lol, not that perfect is wrong, but if you had any understanding of biochemistry and then Use of English, you would have known that precise is the best synonym to give to accurate in this context. DNA follows a precise (acccurate) base pairing of A-T and G-C during replication...As established, you are a lousy biochemist!

Lol, again and again. Misrepresentation as usual. Do you want to start misrepresenting English words again?
Accurate, precise, perfect all mean the same thing. Is DNA replication precise? Or the ADDITIONAL repair mecahnism helps set it straight as I am doing to you now. You must learn biochemistry.

Meanwhile, stop avoiding the questions put to you, explain how an intelligence that is all knowing could be so fallible by creating a system of replication that fails sometimes. Give us a plausible, hypothetical meachanism of how this intelligence created life.

Nb: lehninger and all biochemistry texts agree with abiogenesis, so you should be careful what you reference. The quran is not allowed because it is full of fantasies.

true2god:
Evolutionary biology is a 'subjective' science which has no any universal appeal in the science world and many schools (and countries) have stopped teaching it. The believe in evolution is as delusional as the believe in many religious beliefs.

This sounds more like a subjective opinion. List the schools and countries who stopped teaching it, I'll like to see if it's not the ones who have sworn to hold on to imaginary spirits.

List the countries please, the countries that have opted to teach creation science over evolutionary biology.

You can't just come online and be representing your guesses as facts.

sino:
I have read through your responses, and as usual more gaffes and lack of substance. You are a lousy biochemist, and you apparently don’t even know the biochemistry you are bragging about! See the attached snapshot of where it is stated that replication is very accurate. It seems you have not learnt anything in this past few days, rather than looking for what is not lost up and down on wiki, you need to have a deep reflection on your understanding of biochemistry. I present evidences that keep exposing your ignorance in what you claim to be an authority. In all sense of modesty, if I give you a little idea of what research work I had done, I tell you, you would know that all this your bragging on a faceless forum is quite childish and irresponsible!

Lol, your futile efforts to make it look like I am bragging of biochemistry must be frustrating to you. I am a proud biochemist, you have repeated that in every response. If it pains you so much, isn't it better to just jump in a river than to keep singing it? Perhaps the fact that I understand the essentials of biochemistry more than an ordinary biologist like you is what hurts your butt .

I REPEAT, REPLICATION IS ERROR PRONE. Lehninger attempted to explain DNA replication as error-prone and establish DNA repair as a mechanism that corrects the failures of replication. But how would you even know that? Since you're a biologist and a pseudoscientist who has sworn to misrepresent science in all capacity you can to promote your Allah fantasy. After raising a somewhat silly alarm that I only read a blog, raising a silly excuse that I only read headlines, now you are here showing headlines from Lehninger, lmao. A typical instance of shooting yourself in the skull.

Do you need me to explain everything in biochemistry for you? Well, have I not always done that? Now pay attention and see the explanation below.

Akin1212:
The DNA is not almost error free, it is filled with errors. The enzymes that repair the DNA are enzymes that also helps the DNA during replication. Don't mix these things up with your pseudoscience.

firstly, if you had read through my responses as you have claimed, you would have seen where I made the above statement. DNA replication occurs with errors more often than not, but the mechanism of DNA repair makes it look as if it is accurate, but replication without repair is INACCURATE. It is the reinforcement of the repair mechanism that buttresses replication. After replication, the enzymatic mechanism of repair checks for error in a process known as "proofreading." Replication itself is just the duplication of a DNA strand by DNA polymerase.

Since I have to tell you everything, there you go! I asked you not to mix it up, but you ended up doing that... Facepalm

I don't want to believe you actually think that DNA repair is part of DNA replication, or is that what you actually think?

This was even explained in your screenshot, but because you cannot comprehend biochemistry, how would you even have the patience to see it. You are always quick to explode your ignorance on our face here on Nairaland, Mr intelligent

The following is s statement from Lehninger that you screenshotted - "These mistakes sometimes occur because a base is briefly in an unusual tautomeric form (see Fig. 8–9), allowing it to hydrogen- bond with an incorrect partner. In vivo, the error rate is reduced by additional enzymatic mechanisms." You didn't read through the page, did you? Or your blindness to facts didn't let you see that. Perhaps, Allah blocked your sight and let you miss that? Sino, would a distinctive accurate replication need an additional enzymatic mechanism for repair?

Here is another one - "The fidelity of DNA replication is maintained by (1) base selection by the polymerase, (2) a 39S59 proofreading exonuclease activity that is part of most DNA polymerases, and (3) specific repair systems for mismatches left behind after replication." It is stated clearly that the mismatches left behind are repaired by specific repair systems after replication. Any system of a process that is VERY ACCURATE such as DNA replication according to you would not need specific repair systems. Hence, the repair systems and the replication done by DNA Polymerase is what Lehninger referred to as ' Replication is very accurate.' Next time, read to understand.

sino:
Let me quickly add that errors in DNA replication are repaired, and not that the errors are left as such. This defeats the assumption again that there is no inherent intelligence, and some of the reasons for these errors are also identified, hence the reason for a repair process…

“Any DNA damage must be repaired if the genetic message is to maintain its integrity. Such repair is possible because of duplex DNA’s inherent information redundancy. The biological importance of DNA repair is indicated by the identification of at least 130 genes in the human genome that participate in DNA repair and by the great variety of DNA repair pathways possessed by even relatively simple organisms such as E. coli. In fact, the major DNA repair processes in eukaryotic cells and E. coli are chemically quite similar.

One of such repair process amongst others is stated below:

". The SOS Response

Agents that damage DNA, such as UV radiation, alkylating agents, and cross-linking agents, induce a complex system of cellular changes in E. coli known as the SOS response. E. coli so treated cease dividing and increase their capacity to repair damaged DNA.” (Source: Biochemistry, Voet & Voet)

nb: Since you claim to be a biochemist, I felt it is not important to fully reference a textbook, I expect you to know where to find these quotes, but if you have difficulties like not having these textbooks, just say, I’ll gladly provide you snapshots, as well as those of the journals you don't have access to online.

If after all your bragging you do not know that DNA replication is this accurate, then what is the essence of your bragging?! Again, you have proven that you are just an empty “korodom”!

[/quote]Lmao, don't quickly add anything Oga, your error is highlighted boldly up there for you, save your errors for yourself. You actually don't have the rights to ask if anyone hasn't learned anything, this exercise has been to school you in basic biochemistry, the one you lack. And this is not bragging, it is the truth.

Errors in replication are repaired during replication or after replication? You need to understand the things you are posting here because a lot of people are reading and you don't want to mislead people, the main reason I have been setting you straight. You have posted tons of nonsense here in the name of biochemistry that ordinary screenshots have spurned. I have uploaded a couple to help you further help you understand biochemistry...

The lehninger textbook you quoted admitted that this fidelity of replication is only nearly perfect. Don't tell me you understand nearly perfect as accurate because accurate means perfect. Lehninger explained the accuracy headline, by introducing repair mechanisms to the replicated DNA molecule. If replication is accurate then what's the need for repair? It is very obvious that you do not think at all, I wonder where you get the confidence to publicly misrepresent science from? Are you not ashamed that very obvious things like these are escaping your comprehension? Does your brain not tell you that whatever is accurate cannot be repaired while you type these jargons?

I am not surprised, you don't even know the levels of organization of life, you don't even know that life precedes cells. I believe I am coming to the end of schooling you. You are the one who should be learning here because you are full of ignorance. Even a primary school student knows that an accurate process does not need a repair mechanism. Don't be shocked that I provided screenshots from your most beloved biochemistry textbook, you don't even know that this textbook does not point to Allah creating anything? You don't even know that Lehninger is a proponent of abiogenesis and evolution? Every fact and truth in all biochemistry textbooks or journals you can reference does not point to Allah, they will always buttress my point. I believe at this stage you should start getting ready to take U-TURN and be referencing the Quran.

Your effort to avoid providing alternative theories as to how life began on earth is really amusing but expected. You got nothing to say

I guess I should keep laughing though at the claptrap you just delivered again, seriously Sino, do you think at all? You mean an accurate replication can be repaired?

Why don't you give a plausible explanation of how an intelligence is behind the errors of DNA replication and also planned the repair? Does it even make sense to you that an intelligence that is infallible created DNA replication to fail sometimes and also planned how it will be repaired? Does it?

tintingz:
He wants to compare a human intelligence to an all-knowing-intelligence and thinks it's an argument. I find it absurd I had to quote him.

For the fact that abiogenisis is spontaneous, evolution is modifying and changing, Galaxy formation is colliding and collapsing, arguing that an all-knowing intelligent being(which is God to them) is behind it depict an imperfect God! I'm yet to see an evidence that connect these phenomena with their God.

He also think a random event cannot be studied, that's another flaws from him.

For the fact an event that happened billion years ago was able to demonstrate and create by humans, opened big questions for God.

I'm still waiting for him to answer the questions I asked above.

Trust me, that dude will never answer you. He has failed to deliver a nice mechanism of how this God or all knowing-intelligence created life. He has failed to identify the chaos present in the world and the chaos that are visible in life. There's no way he can justify that the all knowing intelligence created chaos. I will keep luring him out, just watch as he fails woefully. After all, he is more intelligent than the likes of us. And he cannot even understand what life is. Lol

CodeSapien:
Your account is void of the fact that there is a adversary, Satan, who can discourage individuals. It also avoids the power of man to accept their conviction or reject them. "God lays before us life and death and expects us to choose life." I have a willpower to do good and i am open to manipulation. Just like any natural man faced with a opportunity to do self gratifying evil or skip it, we have willpower. Stop assuming Gods goodness negates or overrides man's freewill.

This is what you people tell yourselves to make yourselves happy and convinced that there is God. Whatever happens to God not even subjecting us to a situation where we will have to choose between life and death? What happens to God just giving us life and destroying death. What happens to God destroying Satan forever.

It's your wahala though, you people like blaming man for everything and leaving out the person you claimed started it all. Think for a moment on what you believe and reach a rational conclusion.

tintingz:
How absurd is this argument!

The researcher is not an all-knowing intelligent being reason he's conducting "experiments" with different hypothesis to propose a theory of abiogenisis.

If it's not randomness and comes from an intelligent being, the research won't take this long with different experiments. It would be straight forward and with quick results.

You didn't consider the years they took to come up with those theories, the timeline between today and abiogenisis. Whether they created or replicated a genome and cell both still demonstrate abiogenisis with experiments, they were able to demonstrate what could happened billion years ago! That's an achievement!

And lastly, a random or spontaneous event can be studied, the only problem with spontaneous event is it has no purpose!

All his arguments are absurd and clearly riddled with ignorance. He just want to establish that there is an intelligence where there is randomness and chance. You could see where he said E coli has one error out of 1010 replication, that's not true though, but even why would intelligence give rise to error at all? Does it mean that this intelligence is not 100% and is fallible? He keeps going round a circle, he thinks it's by posting long nonsense.

The researcher demonstrated that the molecule responsible for maintaining and perpetuating life can be synthesized in the lab, and he is here screaming they copied. Does that change anything? Whether they copied or not, they created a synthetic molecule capable of maintaining and perpetuating life. I thought life could not be created before as claimed by religionists, now that it has been done, he is coming up with another excuse of copying a preexisting life.

He didn't consider the years at all, he didn't even consider the fact that it was done. If it was a mystery known only to his Allah, would it be done at all? That's another mystery unraveled and his Allah keeps diminishing.

sino:
How can anyone who claims to know anything about biological science say abiogenesis has nothing to do with the origin of the cell?! I am honestly ashamed of you claiming to be a biochemist. A cell is defined as the basic unit of life, and as I have stated previously, without a cell, there is possibly nothing a DNA can do! If there is no computer, your OS is completely useless! The big question is how did the supposed DNA formed in the primitive earth, and was able to function without a cell?! The research in question have shown the difficulty in making a synthetic genome which still needed enzymes and a living organism! With this balderdash you have written up here, it is very evident that you knowledge about abiogenesis is just pedestrian!

I said it, you studied biology. . And you are here arguing biochemistry and abiogenesis with me, what nonsense! Do you think abiogenesis can be understood by mediocre? You are supposed to be ashamed of yourself instead of me, I am not the biologist who is explaining Biochemistry, you are. Now read some biochemistry again below.

Seriously, I am tired of defining abiogenesis to you, I swear.
I said it, that you must be a biologist, everything you have said has been because you have zero knowledge of biochemistry. You have limited knowledge of this topic and hence you're introducing pseudoscience to help yourself, misrepresenting researches with quack knowledge. I don't want to type epistles, therefore I will just quote Lehninger here for you.

"About four billion years ago, life arose—simple microorganisms with the ability to extract energy from chemical compounds and, later, from sunlight, which they used to make a vast array of more complex biomolecules from the simple elements and compounds on the Earth’s surface. We and all other living organisms are made of stardust.
Biochemistry asks how the remarkable properties of living organisms arise from the thousands of different biomolecules. When these molecules are isolated and examined individually, they conform to all the physical and chemical laws that describe the behavior of inanimate matter—as do all the processes occurring in living organisms. The study of biochemistry shows how the collections of inanimate molecules that constitute living organisms interact to maintain and perpetuate life animated solely by the physical and chemical laws that govern the nonliving universe."

Source: Lehninger, principles of biochemistry, 6th edition, Page 1.

From the above, it is easy to deduce that life is molecular. In fact, biochemistry is the study of life at the molecular level.

In secondary school and the average biology studied in the university, they said the organization of life is cell > tissues > organs > system > organisms. But this is only for simple minds, Life is actually organized from the molecular level, even atomic level. as seen from this source: https://www.studyblue.com/notes/note/n/12-levels-of-biological-organization/deck/15168216

It is very obvious that Sino here is still using his secondary school knowledge to argue with me . Dear Sino, this matter of abiogenesis is beyond you, no wonder you find difficult to understand or fathom how possible it could be...

You don't need to create a cell before you can create life. Life is basically the organization of molecules, while a cell is a compartment or a room where these molecules are, and where the reactions take place. And that is why there are basic branching when we talk about a cell. The Latin word where the term cell was derived from means Room, Cella. A cell is just a compartment. What makes a cell a living thing is the molecular organization found inside it. The cell is not life, the cell contains life. Whew, I hope I have broken it down enough for you Sino!

That is why we have basic types of cells or compartments or rooms, also different cells explain evolution and complexity. From prokaryotes to Eukaryotes, Eukaryotes which can further be divided into basic types, plant, and animal cells. But one thing that remains constant in all types of cells is the biomolecules(life). Bacteria also use the same biomolecules as plants and animals, even humans. Does that not tell you anything? I tire ooo.

This organization is based on the level of dependence on the biomolecules. See below

"The basic principle behind the organization is the concept of emergence—the properties and functions found at a hierarchical level are not present and irrelevant at the lower levels."

Source: https://en.wikipedia.org/wiki/Biological_organisation

From above, it follows that the properties and functions found in the cellular organization are not present and are irrelevant at the level of molecular organization. But they depend on the molecular organization.

The cell can only be alive, the cell is not life. The cell is not the basic unit of life. However, to make it simple for people like Sino, it's better to say the cell is the basic unit of life

Did you say there is possibly nothing the DNA can do outside a cell? Lmao, Sino you will not kill me. So, you don't know that outside a cell, in the presence of polymerase enzymes and other enzymes(suitable conditions), the DNA CAN DIVIDE? Must you always bring your ignorance to the table by saying things you don't know?

You really have to understand the concept of what life is to grasp this explanation, but I hope I have made it simple enough for you. And since abiogenesis explains the origin of this chemical life, abiogenesis addresses the origin of life, not the origin of the cell.

sino:
So with all your bragging biochemist authority, you don’t know how to get a journal fully referenced online except I post a link for you?! Would you also want me to give you access to journals you need to pay for?! Pathetic!

Lol, another trash

sino:
I am a nobody, I agree, but just show me where I misrepresented this research in question. If you do not know the importance of the question with regards to abiogenesis, then you have no business bragging about knowing anything! If you don’t know the importance of the cell as related to the genome to function, then what do you know?!

Oga, a cell means a room. Just as I explained for you above. Nothing more! The life inside a cell is the molecular organization and their interactions. Even humans(organisms) are just like a mansion of different compartments or rooms(cells) that contains life(biomolecules). Sino, think. I am not bragging that I know anything, aren't you the most intelligent? But this abiogenesis, this biochemistry, is my field not yours. Biochemistry is not biology.

sino:
First of all don’t bother your mind about what I studied, but I am surely finding your claim to have studied biochemistry and now claiming authority as very ridiculous with your often repeated gaffes. You should note that even in this minimal synthetic genome, about 17% of it cannot be explained as regards the function, which is about 79 genes out of the 473 genes and these genes were important for the proper functioning of the cell. Mr. biochemist, the excerpt I quoted was to show you what the research is all about, and not your theory of abiogenesis! You need not explain anything to me, the text was very clear even to someone with minimal scientific knowledge!

Oga, I am not bothered. I already know it. Gaffes, indeed! As I said, there is junk DNA, there are even DNA whose functions have not been revealed yet. They are still under study. Stop crying foul because you have always misrepresented this research from the beginning. The fact that you don't even know that a cell is an empty room without its cytoplasmic constituents is even the biggest error.

Lol, the research of Craig Venter was widely known as the creation of synthetic life from chemicals, but no, a pseudoscientist who studied biology objects, lwkmd , and I am supposed to believe him.

sino:
And I will keep telling you henceforth that you know next to nothing about abiogenesis and your knowledge about biochemistry cum molecular biology is very poor! This is not about defending my interest that Allah (SWT) is the creator, but rather the nitty-gritty of a research and your claim that it supports abiogenesis. How can you talk about origin of life and say that the cell isn’t part of it?! You have just shot yourself in the foot by stating the obvious, if the information for making life is in the genome, and you want us to believe that the genome is life giving, how did the first genome give birth to life?! Now I am not even asking too much as to how the genome was formed from the primitive earth constituents, without the enzymes and preexisting life in the first instance, but how did the first genome made its own cell?! Obviously, without the cell, the genome cannot function! And part of the question you should provide answers for is how did this genome randomly “knew” what it needed by making a cell and all its components with unique and specific functions to continue replicating?!

Nb: Venters synthetic genome, will remain a lifeless repository of information without a functional cell, and even if in the future they are able to synthesize a cell from chemicals by a more advance knowledge and tools, it only give credence to the fact that life on earth was never by accident, but definitely brought about by intelligence!

Mr. Sino, what you tell me doesn't mean anything. The research is online, you need to memorize this simple statement and also make it a memory verse - Abiogenesis is the theory of how life arose from simple chemicals, Craig Venter research demonstrates how synthetic life was created from simple chemicals, Lehninger which you love quoting stated that life arose from simple chemicals. Whatever you tell yourself to put your imaginary Allah in the equation does not mean anything, really.

Lol, look at who is looking at the nitty gritty of research? If misrepresentation of research is nitty gritty, then it's over for science
Your argument has been to put an intelligence behind the research which at the end you're hoping to include your Allah as the intelligence. But unknowingly to you, you don't know that you have betrayed yourself. If humans can copy this your Allah as you have stated, what does it mean for this your God? You are obviously not thinking, I thought the Quran said God breathed life and power into the man he molded, how does creating a genome equate breathing life? I don't want to say you are a joker with confidence, but there, I just said it!

You are still confused as to how a cell is not part of abiogenesis? Okay, read this statement again, word by word - Abiogenesis, or informally the origin of life, is the natural process by which life has arisen from non-living matter, such as simple organic compounds.

You see that simple definition above is what abiogenesis is, it's not about how cell came to be, it's about how the process called life started! Don't be confused Sino, it's very simple. You might not understand it until you open your mind.

But if you want to insist on your wrong, lopsided understanding of science, answer this simple question. Is a cell life, or a cell contains life?

Now you are just asking questions you should have asked instead of arguing what you don't know. there are answers to your questions and I would answer them after you tell us the origin of life that you accepted. Tell us about this intelligence you have been screaming created life from his breathe. Let's learn from the most intelligent Sino

sino:
All this epistle isn’t really necessary, even at that, you cannot prove where I lied as you initially claimed, and your claim of misrepresentation is
very laughable. Seems you are discombobulated, and perhaps need glasses, didn’t you see the source in my post?! FYI, the research article I referenced is a 2016 paper, and you are quoting a 2010, although it is still the same work, but Venter and his team were able to create a minimal cell which was optimally functional called syn3.0 unlike the errors they encountered in the 2010 paper. This is very evident in the abstract I posted…If you do not have the means to get some exclusive scientific journals online, it isn’t my fault na…

Secondly, they didn’t create a cell from scratch and that is one of my point, what was said to have been created from scratch is the genome and that is why the title of the paper stated that “Design and synthesis of a minimal bacterial genome”, although this is after they had studied and copied the naturally occurring one…You know it is like copying an OS, use the information you gathered to create your own, then claiming that you created an OS from scratch, but we both know you copied!

The reason this does not support abiogenesis is the fact that they had to transplant the synthetic genome into a cell! Note, the DNA also contains the information for the synthesis of the ‘cell’, so when you want to claim abiogenesis, then we need to ask, was it the cell that was first to be formed or was it the DNA?! As I have stated earlier, the genome will do nothing if there isn’t a cell that would interpret the information, the DNA does contain the instructions to be used in a living cell, but without a living cell, it is useless! All you need here is to prove me wrong!

There is a need to correct you on the starting materials for this experiment, Venter and his team didn’t use just H, C, O, N, P etc. but rather a chemically activated nucleotide, just like in PCR, even at that, the artificial synthesis of the DNA sequence can only reach about 50bp (with all the intelligence o), hence the need to resort to natural living organism and their enzymes to help them reach the very long sequence found in a genome. All these were diagrammatically represented in my post, but you sha want to prove you understand the work, but ending up saying nothing!

The funny thing is that for a supposed unintelligent process of the origin of life, these intelligent scientists have been finding it extremely difficult to replicate, even with all the advancement, and the supposed synthetic genome, they still need the cell, the unintelligent created cell! So what does this tell you?! With all your intelligence, you can only copy, and the synthetic genome give credence to the fact that intelligence is really necessary for life, and not some form of chance or randomness!

Trash, nothing is worth responding to here, I have explained everything I need to explain.

Just provide an alternative theory to the abiogenesis theory, and explain the process plausibly with a hypothetical mechanism.

sino:
"In Fig. 2 is shown a paper chromatogram run in n-butanol-acetic acid-water mixture followed by water saturated phenol, and spraying with ninhydrin. Identification of an amino acid was made when the Rf value (the ratio of the distance traveled by the amino acid to the distance traveled by the solvent front), the shape, and the color of the spot were the same on a known, unknown, and mixture of the known and unknown; and when consistent results were obtained with chromatogram using phenol and 77% ethanol. On this basis glycine, α-alanine and β-alanine are identified. The identification of the aspartic acid and a-amino-n-butyric acid is less certain because the spots are quite weak."

Source:Miller, S. L. (1953). A Production of Amino Acids Under Possible Primitive Earth Conditions. Science, 117(3046), 528–529.doi:10.1126/science.117.3046.528

The abstract of a recent research using advanced research tools to analyse the products from the Miller experiment, had the following information:

"some of Miller's remaining original samples were analyzed with modern equipment (Johnson et al. Science 322:404-404, 2008; Parker et al. Proc Natl Acad Sci 108:5526-5531, 2011) and a total of 23 racemic amino acids were identified"

https://www.ncbi.nlm.nih.gov/pubmed/26508401

It should be noted that the product of this experiment being racemic is the least of the problems of this research, even from the construct of the title, Miller acknowledges the fact that the conditions of the primitive atmosphere was indeed speculative, and further research has shown this to be true!

Mr. Scientist Biochemist authority, the fact that the experiment produced both D and L form in a 50/50 ratio, portends trouble for abiogenesis since you yourself have acknowledged the L-form being the one essential to life! If your lecturers knew their onions, they would have mentioned the thalidomide disaster of 1962 while teaching you chirality of macromolecules, structures and functions!

Your indoctrination is deep that you don't even realize your blunders. The question is, do you really read at all or you just go online to copy and paste statements? Do you know that amino acids can be interconverted? I shouldn't really be arguing biochemistry with someone who is as ignorant as you, seriously. You know little about all these concepts, but you're always quick to run online to look for points you don't even understand. 50% of L-amino acids does not mean that life cannot be formed. Lol


Further research have shown the primitive conditions to be speculative? Oya, show us the research, don't just come here and blab.

sino:
It doesn’t prove anything you say?! But the researcher who is an intelligent being, applying his intellect, synthesize a genome, he claims to have created a synthetic life, and you are here bragging about such achievement and intelligence that wasn’t as a result of any form of randomness, but a well detailed process of planning and execution. But the original life, which the researcher studied extensively to learn and copy from came from no intelligence?! And I am the one with fantasies?!

Lol, again another form of ignorance from you. An intelligent researcher is doing research based on what he can observe and not creating with his intelligence and creativity. Don't you think before you type? Randomness, in this case, means that something with equal chances of not happening happened. How hard is that for you to grasp?
A researcher trying to investigate if there is a possible chance that if certain conditions are replicated will what has been claimed that God created be created? If yes, then the conditions can be said to give rise to these things and not God, since we have evidence for the conditions and we don't have evidence for God.

It's not a matter of using intelligence, is it? It is a matter of humans or certain conditions being able to create what jesterss like you have claimed that God created. If humans can do it, then God ceases to be special and all-powerful, because we can do what he can do. Drop the argument of intelligence because it will not help your cause. And that's a piece of advice.

sino:
I expected you to have claimed that the researchers who claim to have created a synthetic life would have done so out of shear randomness and chance too as abiogenesis suggests, but what we have is the contrary! The problem with your line of thought is that the DNA is not just a randomly organized molecule, it is specific and contains information that can be replicated and expressed to form meaningful macromolecules such as the enzymes you mentioned! If there is no inherent intelligence in these structures, how come there is a need for special enzymes to direct the proper bonding, winding and unwinding for specific functions?! How come there is a process of replication with checks for errors so as to maintain genetic integrity?! How come there is a genetic code that is translated into functional proteins for specific processes and pathways in the cell?! All these were just randomness and chance abi?! But for an intelligent scientist to do anything, he goes back to the unintelligent ‘designs’ all the time! Should you or anyone claim any form of intelligence superior to this unintelligent randomness?! You say I know now book, but you they copy me and you they pass, shey you sure say you get sense so?!

Lol, the laws of nature are just enough to randomly and by chance bring up phenomena. If these laws are changed a little bit, humans might have not existed at all. Let me quickly explain this chance and randomness that is causing problems for you, I will use the same concept that surrounds your belief. You believe that God or Allah just existed, right? From the beginning, God just appeared. There was no prior event or anything that caused it. Right? So who planned the existence of Allah? It was either planned or random and by chance. That's exactly how it is, the only difference is that in science, there is evidence to show, while you don't have any. And that's why heathens like us have embraced science instead of religion.

sino:
Childish reasoning?! What are the right conditions that are going to influence writing a novel by randomly writing 26 letters without intelligence?! Mr. science with an adult reasoning…I have said it before, billions of years is not an intelligent answer, because without intelligence, you possibly cannot achieve anything, our reality has proven this again and again, and the research in question also give credence to this! If my analogy is stupid, perhaps I should use that of Venter, I’m sure he isn’t stupid to have used an OS and a computer. Now tell me the possibility of creating a new OS using any programming language say Python, by randomly writing the codes for billions of years. Let me help you a little, one of the condition is getting the syntax right and debugging. So if per chance you found an OS, you spent all of your intelligence and other material resources to decode it, and then use that knowledge to write yours, would you sound intelligent to claim that the OS you found was as a result of an unintelligent randomness?!

I don't know the conditions that will influence your ridiculous analogy, and that's why I used the conjunction "if." If there are conditions that will make your ridiculous analogy possible, then it will be possible fine fine.

Billions of years, laws of nature, conditions like lightning and radiation which are sources of energy can make many things happen, and they did!. What is intelligence sef? Do you think it is something divine or tangible? let's even define what intelligence is because it seems you are so blind by this term. To be intelligent at all, you have to learn and be rational. this intelligence that you have attributed to God, where did God learn it from? You don't really know how ridiculous you seem when you try to be smart, do you? Any intelligence that created this haven called earth must have been acquired, if this intelligence just popped out of nowhere(randomly appeared), you have not only shot yourself in the foot, you have blown yourself out of this argument into oblivion and the deepest ignorance pit that can ever exist.

sino:
You see when I stated that you are a lousy biochemist, it would seem like an insult, the DNA letters represents the bases in the DNA sequence, it holds information that can be interpreted, the reason for the analogy with the 26 letters. The information the DNA carries are replicated in a process that is almost error free due to inbuilt checks and repairs by specialized enzymes, there are rules that guide this process (it actually looks like it is programmed to do so and not deviate from such programe). A 200 level biochemistry student would tell you this, but because you want to argue, you suspended your brain to attack this basic and very important aspect of the DNA! It is not 8.7 million trials and errors, but rather millions of diverse unique living entities with functioning DNA, that specifically replicate with limited errors, to continue propagating these living entities!

Firstly, if someone who is ignorant claims something, it bounces back because it doesn't mean anything really. You are ignorant and anyone who is vast in science and honest will not waste time in seeing it. You keep posting pseudoscientific nonsense here. The letters of the DNA bases are just representative letters of how the DNA is constructed how does this compare to 26 letters Writing a perfect Novel? The DNA is not almost error free, it is filled with errors. The enzymes that repair the DNA are enzymes that also helps the DNA during replication. Don't mix these things up with your pseudoscience.

I don't blame you really, some scientists also believe that this their imaginary friend programmed everything but have failed to identify who programmed this their imaginary friend or he just puffed up and started existing "RANDOMLY and by CHANCE." If you apply your rejection of life existing randomly and by chance to God existing randomly and by chance, how will it come back?

Secondly, the DNA is not error free, it is filled with errors. And this basic reason was why scientists who have really worked with the DNA rationally reached a conclusion that no intelligence is behind these things.

sino:
"Replication Is Very Accurate

Replication proceeds with an extraordinary degree of fidelity. In E. coli, a mistake is made only once for every 109 to 1010 nucleotides added. For the E. coli chromosome of ~4.6 X10⁶ bp, this means that an error occurs only once per 1,000 to 10,000 replications." (Lehniger, Principle of Biochemistry) I hope you wouldn’t request for the link to this…

Again, there are some of human creation or let’s call it inventions that are purely chaotic, does that mean there was no intelligence behind it?! Are you sure you are thinking right like this?!

Lol, please and please, let us stay on science alone. I am tired of correcting your pseudoscience. For the records, REPLICATION IS NOT ACCURATE. And this inaccuracy shows that this is not a work of intelligence. I don't know where you saw that replication is accurate, but I am not surprised since you are a renowned pseudoscientist. Why would an error occur at all even once in E. coli if it was programmed by this intelligence you have so much hung up to? Can we say this intelligence is fallible? Or is there any purpose this intelligence programmed these errors for?
If humans have creations that are purely chaotic, and this your God also have creations that are also chaotic, are we now placing humans and this your God on par on their creations and intelligence? I have finally lured you out Sino, lol

Perhaps, randomness and chance are just purely responsible for the order and the chaos?

You really need to start thinking because you are already sinking.

Crysthaniel:
Please read Ezekiel 42:12 Revelation 22:2

Please go and learn what reality is.

Crysthaniel:
The Bible actually covers the universe from it's origin to the very future.. please read Isaiah 40:26 Genesis chapter 1v 1
Amos 9:13 gives us something God will do in the future

The bible covers nothing but your fantasies. It didn't even tell us how to cure ordinary malaria

Crysthaniel:
Yeah the faculty of Love emphaty kindness proofs that the Bible account that God created us in his image is true Genesis 1:27
1john4:8

The universe is 13 billion years old, the planet earth is 4.53 billion years old, the human race is 8 million years old, empathy has been around for about 8 million years old hypothetically. The bible is less than 2000 years old, how can the command of what has been existing come from the bible?

It's more like you're saying, a child gave birth to its parents. Does that make any sense to you?

Empathy does not prove that we were created by anybody. It's just social engineering.

Crysthaniel:
It's actually Gods word that gives this command
Mark12:30-31
The plain Truth is this:
If I truly love my neighbor it means that I love God
And if i truly love God, it will be very easy for me to love my neighbor.. 1john 4:7-21

So before the book of John was written less than 2000 years ago, there was no empathy? You are truly deceived. Empathy is not a command, it's common sense and it has been practised well before the Bible was written.

Your neighbor at least we can prove, but who is God? Wake up abeg.

Golden6:
Then ASUU decides to fall my hand shaa ... Lolzz.. well .. it's good they finally decided to call of the strike though

You're on the right path. There's no God anywhere, and there's no purpose. But since we have found ourselves here on earth where other life forms exist aside ours, other people exist and we are socially engineered to live together, please employ empathy. Empathy will guide your moral standards, it is very important. Do unto others, what you would like done to you. Good luck

sino:
[s]I would repeat it again; my level of intelligence is way beyond your likes that are very lazy to do any form of research (including reading and understanding a published journal) but come on a faceless forum to brag about being a scientist or a biochemist! I would help you post the primary objective of the research by Venter, to show your ignorance the more:[/s]

Trash. What an irony about the understanding of the journal. Am I supposed to take someone who asked a silly question whether the genome functioned as a cell serious? You don't even know why the genome was inserted in the yeast cell and you're here talking about understanding the journal. Mtchew, lol Mr intelligent.

It was very important I mentioned that I am a biochemist when we started talking about abiogenesis, unlike you who is nobody, and keep misrepresenting a journal you purposely refused to post its source because of your sheer and obvious intellectual dishonesty. It was not a bragging, I only claimed the needed authority on the topic of discuss which is the origin of life, because biochemistry is the study of life at the molecular level. I know it has been giving you sleepless nights since a month ago that I announced what I studied in school,please I beg you sir Sino, deal with it.

sino:
"Here we report a new cell, JCVI-syn3.0 (abbreviated syn3.0), that is controlled by a 531–kilobase pair (kbp) synthetic genome that encodes 438 proteins and 35 annotated RNAs. It is a working approximation to a minimal cell. Its genome is substantially smaller than that of M. genitalium, and its doubling rate is about five times as fast." (Ibid.)

Like I said, you know zilch about this topic, I am not even supposed to be going back and forth with a novice like you. Tintingz actually said yoh studied science, maybe biology, but biochemistry is totally alien to you. You are empty when it comea to this field. It has been established that the total genome of all living things contains functional DNA(genes), and junk DNA that basically do nothing. In light of this, if the synthetic genome is a minimized genome compared to the natural, it only means that all or part of the junk DNA was not included. This does not mean that the synthetic genome will still not power the functions of life in the DNA.

But I still have to explain that to Mr intelligent who has in his mind claimed to be intelligent that the likes of us explaining simple processes to him.

sino:
So vreating

Craig didn’t claim to have proved abiogenesis, and moreover, he and his team still needed life, that of yeast and a bacterial cell for their synthetic genome to function.

This brings back to the quote from a leading geneticist again:

“To my mind Craig has somewhat overplayed the importance of this,” said David Baltimore, a leading geneticist at Caltech. Dr. Baltimore described the result as “a technical tour de force” but not breakthrough science, but just a matter of scale…. [b]“He has not created life, only mimicked it,” [/b]Dr. Baltimore said."

Instead of all the unnecessary theatrics, long stories and attaching picture of a genetic code (does calling it a code also baloney since a code would definitely require a programmer?!), just show me my bogus lie and how I misrepresented him, don’t come quoting a Professor of practical ethics to me or making spurious claims, rather show how this research by Craig created life from just chemicals to prove abiogenesis!

Lol, I am not defining abiogenesis again for the umpteenth time
By now, if you have read the first two response to your trash, you must have gotten the picture. And if you don't, I wish you luck in your ignorance.

Anybody, of course religious bigots like you can claim that the synthetic bacteria is not giving life to the bacteria cell to shield your interests of Allah or God. It is allowed. But the fact is that, the bacteria is surviving on the synthetic genome made from ordinary chemicals. If this does not support the theory that life arose from chemicals, I don't know what else it supports. Lol.


Meanwhile, I am waiting for you to give me plausible hypothetical mechanisms on how God or Allah created life as I have given you on abiogenesis.

And remember, in case you argue this matter with someone else. Abiogenesis is not concerned about how cell came about, or how humans came about. It is how life came about. But then, you have to understand what life is in the first place. And don't also forget that the genome also contains the information of making a cell

sino:
It is impossible for the synthetic genome to function without the machinery for reading and translating the information embedded in it, further replication after transplantation means that the synthetic genome contain the necessary information to continue living and not starting life from the scratch! The critical question you need to ask yourself is that was the recipient bacteria dead?! FYI, a dead cell cannot and will not translate or read any information transplanted into it! It is just like the OS analogy, if the computer is dead, there is absolutely nothing your new OS will do, except the computer is working, you format the hdd, and then install your own OS! I hope this is clear enough!

I have actually explained life up there. Go back there to read it and think after reading it.

The synthetic genome has all the information to start life or continue it. The bacteria cell is not alive if it's not carrying out homeostasis or metabolic reactions. And yeah inasmuch as the natural genome was excavated, the bacteria will die and the synthetic genome will restart or restore the life process and further continue it. The natural and synthetic genome carry out the same functions, if the natural genome can start the biological functions, so will the synthetic genome. Is that not the common sense you talked about earlier?

Lol, incoherent analogy again. Let me destroy it one more time. Can the computer function without the old OS? If the old OS contains the information that gives the computer life, and you put a new OS, you have given the computer new life by installing the new OS. Please learn to think properly before giving analogy.

The argument is the origin of life, processes that the information are encoded in the genome. The argument is not the origin of cell or origin of anything that contains life. Don't make the argument what it is not. Stay on point. Abiogenesis does not care about the cell or the bacteria compartments. Abiogenesis only cares about the biological functions that characterizes life. What is life, don't bring arguments about the bacteria cell being dead or not, does the synthetic genome made by humans give life or not? If you like call it continuation of life, in my dictionary something that continues life still gives life.

Now, that we have written epistles on the theory of abiogenesis, and evidence, journals and definitions have flown from left to right. Can you give us evidence on your part of how life started since you are rejecting the honest theories of science?

sino:
Of course you couldn’t refute the other points I raised which is actually backed up by further research, but rather hold on to amino-acids being ‘alive’ as an easy way out. Please tell me how the Urey-Miller experiment proves abiogenesis?! How did the supposed racemic amino-acids give rise to life?! No scratch that, what were the amino-acids produced and how did this experiment account for at least 50% of the amino-acids required to synthesize necessary proteins that are essential for life?!

Again how did the polymerization of these amino-acids happen?! These are part of the questions my ‘alive’ was referring to, but it doesn’t matter to you, if the experiment as well as further experiments cannot answer these questions and even more, then you are believer, having blind faith in science!

As much as this is laughable, once again you have succeeded in shooting yourself in the foot. And this time, you did exceptionally. Your desperation to establish that I have faith in science which is nothing but a laughable failed clapback has been noticed. But guess what, you're just making noise.

Anyone with knowledge in science will not find it difficult at all to see your obvious flaws littered in the jargon it took you two days to put together up there. But in the jargon, I will make bold your errors for you to see. It's left to you to see them.

- Just do yourself a favor and stop talking about science, amino acid don't give rise to life. Perhaps, you don't even know what life is, perhaps you think there's a particular thing called life in living things. I give up on your ignorance Sino.

- Amino acids are either D- amino or L-amino. But the ones found essential to life are L-amino, which were produced in the Urey-Miller experiment. This is however a plausible evidence that life through abiogenesis. But instead you believe that God breathe amino acids into humans, but can't prove it. Did God also breathe life into plants and other animals too? Explain to us or read to us from your trash book extensively how God gave life to living things, please.

sino:
The joke is on you Mr. Scientist, the research and researchers you are referring me to use the word design repeatedly through their research article, perhaps they were stupid to have used such a word?! You don’t get it, when you make use of structures to describe something, you are inadvertently acknowledging there is a design, a pattern, be it uniform or not (but this case uniform). These bonds are quite important for the functions of these macromolecules, and in the DNA, it isn’t just random bonding, but information-driven bonding which enables it to function optimally with respect to its replication and transcription. The bonds, the number of base pairs per turn, the form found in physiology are so unique and important that you can’t deny the intelligence! You ought to know about structures and functions na, but alas! Here we are… What the researchers have been able to do is study and learn from a naturally occurring DNA (genome), designed their own with the aid of a computer! If they say they design, who are you to question this?! And of course if they actually had to design one, common sense dictates that the naturally occurring one must have also been designed! Oh i forgot, common sense they say, isn't common!

Life happened no doubt, but my question is given similar billions of years, and with 26 alphabets to be randomly written, what would be the chances of writing a best-selling novel as well as other diverse meaningful story books, letters etc.?! Does it look plausible to you?! From the single unicellular organisms to the complex multicellular organisms, do you see any purposeless living organism?! How did this randomness ‘create’ such a working order using just 4 ‘alphabets’?! That is the big question your randomness and chance are yet to answer!

Lol, a scientist like you, or better a science critic like you who finds it difficult to criticize your faith is so obsessed with the word DESIGN because it so much fits and favors your narrative of a designer or a creator which you always hurriedly call your God or Allah. You see, it's not about a designer or anyone, just drop it and stop validating nonsense. They could use the word design in journals and they could also use code, they could as well use program, and the same way I can as well use DNAer or a builder. The only difference here is your particular choice and insistence in using the word designer which long last doesn't still prove anything. Please apply intellect, don't be a subject to your fantasies. Let's know what we're doing.

You are getting a wrong notion and use of the word random or its use, arent you? Perhaps you don't deeply understand Science to that point. Do you know that something can randomly be organized? Do you know that certain atoms will only bond to specific atoms at certain conditions and will continue to bond if the condition persists? The bonding in the DNA can be organized by chance depending on the conditions present prior to the bonding which is important for the structure of these molecules. And this bonding is also controlled by enzymes providing reactive active sites for them to happen. There's no inherent intelligence behind it, you have just made another bold claim. You have just once again filled the gap of knowledge by attributing the observation to an intelligence that cannot be proven. Why, ehn why? If these enzymes are removed, if these conditions are changed, the bonding will not take place at all, no matter what the intelligence you claimed has done. And these conditions are what we have termed the natural laws in science. So has your intelligent creator not failed if humans can alter his intelligence?

Lol, so common sense is that if they designed a genome by looking at the natural one, then the natural one too was designed? Lwkmd, you will never cease to amuse me. Okay then, let's apply your common sense. If the artificial genome which is observable was designed by observable beings, common sense should also tell us that the natural genome which is also observable too should be designed by an observable being. Now, where is the designer who designed the natural genome? Don't give excuses here Sino, just provide the designer instanta. . Let's see how common sense is so common to you, Mr intelligent.

Let me guess, you cannot! You must be a joke bro.....

Your question about alphabets is a result of your childish reasoning. You must have skipped logic classes in maths in secondary school, or perhaps you didn't do permutation and factorial in mathematics. However, I will try to help you think better bro, after all you have claimed that you are more intelligent than us.

Given billions of years, I don't know for sure if a novel can be written from 26 letters, but if the conditions that can incluence iit are available, it will be written fine fine, despite the fact that the analogy is stupid as usual. Billions of years is not 100 thousand years. Open your mind and learn. And this looks plausible than the useless claim or excuse that Allah did it, Allah did nothing!

The 4 letters in DNA code is just informative letters that tell us how nucleotide bases are arranged in the genome, and different arrangements of the codes has lead to 8.7 million trials and errors. By saying it gave rise to a working order is another nonsense from you. It has created order and also chaos. We have seen people who were born malformed because of the chaos this randomness can cause. Or do you think humans or other animals are perfect? You are really a joke bro. You know nothing!

sino:
You have just shown that you lack the understanding of the science in the research, but merely do follow-follow. So if I copy windows OS to write a code for my own OS, Did I create a new computer or a new OS?! Don’t you know the difference between Hardware and software ni?! You see, I omitted the reference for my quoted post for a reason, to weigh your understanding of what is being discussed here and not some propaganda believes about abiogenesis…. I will help you with quotes from the original research paper, the abstract and part of their discussion and conclusion, then you must show where I lied! Please take note of the word DESIGN!

DESIGN and synthesis of a minimal bacterial genome

Abstract

We used whole-genome DESIGN and complete chemical synthesis to minimize the 1079–kilobase pair synthetic genome of Mycoplasma mycoides JCVI-syn1.0. An initial DESIGN, based on collective knowledge of molecular biology combined with limited transposon mutagenesis data, failed to produce a viable cell. Improved transposon mutagenesis methods revealed a class of quasi-essential genes that are needed for robust growth, explaining the failure of our initial DESIGN. Three cycles of DESIGN, synthesis, and testing, with retention of quasi-essential genes, produced JCVI-syn3.0 (531 kilobase pairs, 473 genes), which has a genome smaller than that of any autonomously replicating cell found in nature. JCVI-syn3.0 retains almost all genes involved in the synthesis and processing of macromolecules. Unexpectedly, it also contains 149 genes with unknown biological functions. JCVI-syn3.0 is a versatile platform for investigating the core functions of life and for exploring whole-genome DESIGN.

So does this explain abiogenesis?! Let’s go further into the article....

"Genomics is moving from a descriptive phase, in which genomes are sequenced and analyzed, to a synthetic phase, in which whole genomes can be built by chemical synthesis. As the detailed genetic requirements for life are discovered, [b]it will become possible to design whole genomes from first principles, build them by chemical synthesis, and then bring them to life by installation into a receptive cellular environment. We have applied this whole-genome design and synthesis approach to the problem of minimizing a cellular genome."[/b]

The bold might be a little bit confusing, but I’ll explain, you see the synthetic genome is what is built from scratch, of course with the help of learning from the original design, and this did not form a life on its own as it would be shown later…

"In contrast, we set out to construct a minimal cellular genome in order to experimentally determine a core set of genes for an independently replicating cell. We designed a genome using genes from M. mycoides JCVI-syn1.0 (10). This mycoplasma cell has several advantages for this purpose. First, the mycoplasmas already have very small genomes. They have evolved from gram-positive bacteria with larger genomes by losing genes that are unnecessary in their niche as mammalian parasites. They are already far along an evolutionary pathway to a minimal genome, and consequently they are likely to have fewer functionally redundant genes than other bacteria. We also have a highly developed set of tools for building this genome and for assembling and manipulating the genome as an extra chromosome in yeast."

The first introduction of this synthetic genome to life can be seen here where it is placed and manipulated in a yeast cell….So what happens after?! Did this genome start functioning as a cell on its own to prove what Mr. Scientist wants us to believe about abiogenesis?!

What actually happened is the transplanting of the manipulated genome into an already existing bacterial cell.

"At each cycle, the genome is built as a centromeric plasmid in yeast, then tested by transplantation of the genome into an M. capricolum recipient." (See attached picture).

Source: Clyde A. Hutchison III et al.Design and synthesis of a minimal bacterial genome Science 351, (2016); DOI: 10.1126/science.aad6253

How does all the above different from what I posted, or how does it show that I lied Mr. Biochemist?!

Thank you for this. I suppose you omitted the source to cover your dishonesty once again. But to show you that before you even thought of misrepresenting the research once again,I have read the journal over and ober again. I will include my source and I will also highlight where you misrepresented in the journal. Aside from the fact thay you didn't specify your source which automatically disqualifes your jargon.

1. "They used whole genome design and chemical synthesis" specifies that chemical raw materials were used to make artificial or synthetic DNA which could carry out the same functions of a natural DNA inside a cell from scratch. What part of this is actually difficult for you to grab? This alone, proves that life can arise from chemicals or organic compounds which excellently explains abiogenesis.

2. Lol, you actually used your hand to bring a source, but the content of the source does not suit your narrative but you had to narrate it in a way that fits the Allah agenda. Let me explain the whole concept of life, genome and cells for you. Maybe, just maybe you'll wake up from your ignorance.

You see, living things are their genomes. The genome is the complete genetic information of an organism or a cell. The genome consists of coding genes(exons), non coding DNA(introns), the DNA inside the mitchondria and also inside the chloroplasts.

Now, life on earth is defined scientifically as a series of processes or metabolic reactions that give rise basically to the following biological functions. Movement or locomotion, Respiration, Nutrition, Irritability, Growth, Excretion, reproduction and death. This is basic integrated science. Right? And that's just on the basic level, but it also applies on all levels. In another explanation, biochemically precisely, anything that can perform anabolism and catabolism is alive.

Now, cells carry out the biological functions and they also carry out anabolism and catabolism, a cell is nothing but a compartment where these reactions take place.

The genome is the information bank for these biological functions and reactions. The genome is where the information of how these processes should be done is stored

So, if genomics is now moving from a descriptive phase to a synthetic phase where whole genomes can be built by chemical synthesis, it means we can build a whole genome from starting chemicals such as Carbon, Nitrogen, hydrogen and oxygen. This consequently means that we can build from ordinary chemicals the information required to sustain life or start life. This means that we can create life in its simplest form. Is it not easy to grasp?

Even if we learnt from the natural sequence and created our own sequence, does that mean we didn't create a synthetic life? Religious bigots have always asked scientists to create a life to convince them, now that it is done, they are coming up with excuses that it was copied from the natural one. Meanwhile, before, their bragging was that we can create things, but we can't give them life. This is becoming ridiculous lol.

The most important thing here is that, these scientists created a synthetic DNA, excavated the natural DNA without which the bacteria would be dead and incorporated the synthetic DNA which works just like the natural DNA. Is that the creation of life?

Their excuse now will be, why didn't you create a cell?

3. Your third flaw was also highlighted, its a shame you don't understand science, nor the research you're misrepresenting but you claim you do. Lol

A person who understands this research will not even ask if the genome started functioning as a cell. What kind of ignorance is this? In your quest to appear intelligent, you keep showing how unintelligent you are. This is another intellectual suicide. Can the DNA function as a cell? A cell without a DNA is dead. The artificial genome created was incorporated into

The following abstract says it all, the source is included in my own case.

Abstract
"We report the design, synthesis, and assembly of the 1.08–mega–base pair Mycoplasma mycoides JCVI-syn1.0 genome starting from digitized genome sequence information and its transplantation into a M. capricolum recipient cell to create new M. mycoides cells that are controlled only by the synthetic chromosome. The only DNA in the cells is the designed synthetic DNA sequence, including “watermark” sequences and other designed gene deletions and polymorphisms, and mutations acquired during the building process. The new cells have expected phenotypic properties and are capable of continuous self-replication."

From the research article, if Sino by chance knows anything about molecular biology, he would know why the genome was inserted into yeast cells. But I guess I'll have to help him again, read below from the source.

"We developed a strategy for assembling viral-sized pieces to produce large DNA molecules that enabled us to assemble a synthetic M. genitalium genome in four stages from chemically synthesized DNA cassettes averaging about 6 kb in size. This was accomplished through a combination of in vitro enzymatic methods and in vivo recombination in Saccharomyces cerevisiae. The whole synthetic genome [582,970 base pairs (bp)] was stably grown as a yeast centromeric plasmid (YCp) (7)."


It is obvious that the genome was assembled by enzymatic process and by recombination process in yeast. Sino wouldn't understand that, would he? I will not respond further, here is the link to the source, the link which Sino refused to post because of his dishonesty. Biochemistry is very simple.

http://science.sciencemag.org/content/329/5987/52.full

usermane:
Hmmm....! Didn't know about this, despite all my inquiries into abiogenesis previously. I'll need to verify the veracity, though.

Here is another one, I guess you haven't really made your enquiries well enough.

https://www.telegraph.co.uk/news/science/7745868/Scientist-Craig-Venter-creates-life-for-first-time-in-laboratory-sparking-debate-about-playing-god.html

usermane:
For a man so sure of abiogenesis, should it be too hard to see the earth's biomes as end yield of alien lab work? Could these highly advanced and intelligent aliens be whom the theists perceive as God?

And what plausible, objective evidence do you have of these aliens? Or you want me to see by just imagination as usual? You're just cooking upnnew bullshits that's similar to what theists have. Prove your claims and stop deceiving yourself.

usermane:
Oh, I was talking about how individual experiences shape their beliefs. People who are very religious can share many stories of how they feel this special connection to God. A sort of supernatural force that they can't explain but they can feel through their worship and prayers.

No one can explain delusion enough that others will get it. Delusions are always personal. Don't you know?

usermane:
Why? Can't a loving father punish his son?

You see what am saying? It just doesn't end. For almost every flaw you find, theists seem to find a way around it. And so, as atheist, you're forever trapped in this endless loop.

A loving father cannot punish his son. Can a loving father boil 'hot' water to pour on disobedient children? What happens to helping them understand their disobedience and plead with them to change. That's another option a truly loving father will take.

Theists don't have a way around anything, aliens are not God because aliens would also be born or created according to theists logic. Because you cooked a story up doesn't mean you have a way around logical criticisms. It only means you have blocked yourself from accepting an objective truth. And that's stupidity, sheer stupidity which is rapidly becoming the main feature of every theist.

tintingz:
Lol, I've been arguing with him for long.

He claim he studied science fine, but his posts are like pseudo-scientific claims. He's quick to attack science and discredit their research. I wonder if he understand what scientific theory means, if he understand a scientific consensus. He thought atheists take science as a religion or so.

But ask him to provide evidence for his God existence and creation, he will start jumping from one fallacy to another fallacy and the ridiculous thing is his fellow Muslims will jump in the thread cheerleading his fallacies and join him with fallacies.

That's why i make sure my argument are strictly base on logic, the only way to argue moderately when you're in a den of fantasy thinking people is to use logic and know every fallacy they commit.

Just ask him to provide evidence for all the claims in their fairy book and see him run pass Usain bolt.

I realized he studied science but someone like him must have studied not to learn but to just go to school. You could obviously see his pseudoscientific traits.

How can someone who actually learnt science not know what an evidence is? Nobody's word is an evidence, not even Mohammed's. They only believe in his fantasies.

Anyway, let me join you in waiting for the evidence he will provide for the existence of his God and how life started on earth.

tintingz:
Akin1212, wow, I wish I studied science.

Anyways, our brother Sino is yet to explain how he knows Allah was the one that created him, with empirical evidence.

Lol, science is beautiful. The fact that it studies our natural world alone is incomparable to anything. Without science we wouldn't be here at all. If we were to rely on all these fantasies and fairy tales, we wouldn't have done anything.

Sino cannot provide any evidence, that's why his counter arguments are to attack my personality as a biochemist and to discredit us by saying we also believe scientific facts because we were not the ones who did the research. Indirectly, he is saying every scientist must do the research they want to promote. . He has failed to realize the objectivity of science. Scientists try as much as possible to be objective in everything they do, hence the publishing of journals. You must provide detailed information about what you did, that's one of the 5 rules of a research, it must be reproducible, else it's not accepted. This changes everything because in religion, only selected few can be prophets. God will never talk to ordinary people, how can God expect me to listen to an illiterate Arabic man when I cannot even speak Arabic. So I must learn Arabic because I want to know God? God cannot speak to me or someone from my locality too? It's all laughable, you know.

And not to forget, another intelligent Sino's argument is that Allah did it and that's because it was written by Mohammed from Arabia . Lmao.

Okay, we need a plausible hypothetical mechanism of how Allah did it, abi? I think we know his response already, we cannot know because our knowledge is too small compared to the information

sino:
The joke is on you, contrary to what you have written about science not being believed, your post suggest you don't even understand the science! Hence the need for a faith in science! You have repeatedly showed lack of understanding of the science you present!

Sigh, once again I have to address mediocrity.

Not much to say here, you're only explaining what you perceived. Not really worth responding to.

sino:
Your posts are always riddled with ad hominem, but hey, it doesn't matter, because you are way over your head with your ego...

You presented your supposed hard evidence to support your claim, and I critic them as not being enough to arrive at your conclusion! Theories are meant to be falsifiable, there is no absolute truth when it come to some of these theories and even supposed facts, especially when there is still room for more research! When you reach that level of intellectual humility, you won't come on a faceless forum to be bragging about research you know next to nothing about other than reading excerpts from online news blogs!

You critic the evidence or you critic me? Lol, we will have a breakthrough when you stop attacking me and instead focus on the matter. You cannot drive home your points by attacking me or attacking what I studied in school. It is unbecoming to the hopes of you unlearning, learning and relearning. And you really need to.

If you critic provided evidence, then why can't we critic your belief. Evidence is more reliable than mere faith which is totally based on 'the prophet says Allah said,' just hearsays.

Theories are meant to be falsified based on further research and experiments, not by a random Sino on Nairaland.

It surprises me that you of all people is saying there is no absolute truth when it comes to scientific theories, but the same you actually believes that Islam that is rejected by over 5 billion people in the world is an absolute truth. . It says so much about your intellectual truth and humility. Scientific theories with evidence are being rejected by the likes of you who lack understanding of them because you have sworn to adhere to fantasies and fairy tales, just as the one we did before we were allowed to comment in this section.

Scientific theories are open to further research and questioning, and that's the honest thing about science. It has to be true here in Africa and also in Asia. Unlike your religion which is only true in certain places in the world and is very much closed to criticism and questioning. Isn't it?

That I know close to nothing about the scientific research I quote here, you can continue throwing jabs if it makes your day lol, but it doesn't change the fact that Allah does not exist anywhere.

That's why they are called references my friend. The journals are online, detailed processes of how the work was carried out, the apparatus and materials used, how the conclusions were reached etc are available for anyone who wants to reproduce the work. That's clearly the highest form of honesty. And Sino, that obviously is better than saying we cannot see God bla bla bla, better than saying only the prophets can hear from God bla bla bla.

sino:
Instead of providing the supposed incontrovertible evidences, Mr. 'Scientist' goes on personal attacks, you keep proving you know next to nothing about these researches...You should rather take your advice and perhaps save yourself from this embarrassment!

I guess I should stop taking you serious. Who takes someone who does cognitive dissonance serious?
After saying I provided some experiments as facts, after saying I provided the arrangement of synthetic DNA as facts, what other evidence are you asking for? Or what evidence have you provided for your claims?

Saying amino acids are alive is tantamount to committing an intellectual suicide. I don't know how to save you from that than to bury you. RIP.

sino:
Mr. biochemist, what did the researchers do with the computer to 'create' the synthetic DNA?! Again, no substance in your response, at this rate I can clearly see that you are actually bereft of any biochemistry knowledge...If not so, you must have been taught a bit about structures of biomolecules, specifically the DNA molecule being a double stranded helix with proportional measurements and angles. If you have any form of advance studies in biochemistry, you would have been introduced to biophysics of the DNA molecule...Wait, aren't you the biochemist here?

You absolutely have no clue! Just tell me how a billion base pairs was just from a random occurrence?! Were there failures too?! and what kept this random process to continue so as to create these COMPLEXITY and DIVERSITY (since you didn't see this before) we now see?! What sort of randomness brought all these things to work together so astonishingly and awesomely?! Billions of years isn't an answer, for no matter how long you keep writing alphabets randomly, you can't write a best selling novel even a primary school level story book!

You just have to always introduce a certain level of ignorance to science whenever you struggle to describe it by introducing your creator theory. This same you believes that the creator designed everything but the creator was designed from nothing or not designed at all. . This is the highest level of dissonance I have ever come across. Yet, you have zero evidence of this creator.

Researchers arranged DNA strand with the computer, does that make them designers or researchers? When you don't take your time to think deeply, you will always be a joke.

Lol the twist angles or the angles of rotation of the DNA double stranded molecule is not a proof that someone did it, it is a proof that the DNA consists of non living atoms that bond with themselves. When atoms form bond with themselves, as a result of repulsion, angles are formed. And since the atoms are repeated in the DNA molecule, the angles will be uniform. Don't always fill the gap of knowledge with fantasies.

Again, you're shooting yourself in the foot. It took 3 billion years after the formation of the planet earth for man to surface. In 3 billion years which is close to forever, there's every chance that man could come or something else could come, but man came. It was a chance, or do we need to explain chances for you again? Man was not the first form of life, and the randomness obviously produced diversities of life, which is about 8.7 million species. What's so hard in understanding this? Life is the random occurrence and it happened, so deal with it.

sino:
Wow, I don't understand how reactions work or the biosynthesis of nucleic acids?! Pray tell, how did you arrive at this conclusion?!

What Craig Venter did was to copy already existing DNA, synthesize it in the lab add watermarks and then incorporate it into an already existing cell! He even used the computer software as an analogy, so Mr. biochemist, if I took an OS say ubuntu, which is open source by the way, and make some changes like the welcome screen to show my name, that means I have created a computer?! As I have said earlier, synthesizing DNA in a testube does not mean you have 'created' life!

Your evidences thus far hasn't proven abiogenesis, you were told earlier that there is still a long way to go, even the researchers were humble enough to acknowledge their limitations, but you who is just reading online blogs is all over here bragging!

You said science doesn't need to 'create' life before I accept that it is the truth, but you are the one always demanding such incontrovertible proves and evidences before you accept anything as true, the evidences of the supposed processes you have provided thus far does not prove abiogenesis! So until you can provide the objective evidences to show abiogenesis, you are just believing it based on faith!

Let me help you understand your ignorant bragging here:

Akin 1212: "Artificial life is history." Provides evidence from a researcher called Craig Venter

What Craig Venter et al. did: "Then in 2010 they made the first self-replicating synthetic organism, manufacturing a version of M. mycoides’ genome and then transplanting it into a different Mycoplasma species. The synthetic genome took over the cell, replacing the native operating system with a human-made version. The synthetic M. mycoides genome was mostly identical to the natural version, save for a few genetic watermarks—researchers added their names and a few famous quotes, including a slightly garbled version of Richard Feynman’s assertion, “What I cannot create, I do not understand.”

With the right tools finally in hand, the researchers DESIGNED a set of genetic blueprints for their minimal cell and then tried to build them. Yet “not one design worked,” Venter said. He saw their repeated failures as a rebuke for their HUBRIS. Does modern science have sufficient knowledge of basic biological principles to build a cell? “The answer was a resounding NO,” he said." (Emphasis are mine)

For emphasis, “To my mind Craig has somewhat[b] overplayed the importance of this[/b],” said David Baltimore, a leading geneticist at Caltech. Dr. Baltimore described the result as “a technical tour de force” but not breakthrough science, but just a matter of scale…. “He has not created life, only mimicked it,” Dr. Baltimore said."

Indeed, artificial life is history according to our own nairaland 'distinguished' biochemist

Lmao . SIno, Sino, you went through all these to present a lie? I'll make it easy for you and anyone reading. I will quote the first paragraph of the source, I will then define abiogenesis, I will then quote some other paragraphs of the source and then I will finally address your baloney once more. Here we go....

First paragraph of the source : "Dr Craig Venter, a multi-millionaire pioneer in genetics, and his team have managed to make a completely new "synthetic" life form from a mix of chemicals."

Definition of Abiogenesis : "Abiogenesis, or informally the origin of life, is the natural process by which life has arisen from non-living matter, such as simple organic compounds."

From the above, we have seen that Craig Venter and his team made a completely new synthetic life form from a mix of chemicals, and we have also seen that abiogenesis is the natural process of making life from simple organic compounds.

But our dear Sino has quoted something else entirely, dishonestly explaining what the article or source does not explain. Why do you lie to yourself Sino?

Further quotes from the source : "They manufactured a new chromosome from artificial DNA in a test tube, then transferred it into an empty cell and watched it multiply – the very definition of being alive." --- From synthetic DNA that was arranged, they made a new chromosome that was able to divide and multiply. This however quenches the arguments that life comes from God, and further validates the scientific position that life is just a series of reactions or processes.

Further quotes from the source : "The man-made single cell "creature", which is a modified version of one of the simplest bacteria on earth, proves that the technology works."----- The cell is completely man made from scratch and it is a prototype of the simplest bacteria on earth, but this one is modified with watermarks to differentiate it from the natural bacteria.

Further quotes from the source : "First they sequenced the genetic code of Mycoplasma genitalium, the world's smallest bacteria that lives in cattle and goats, and stored the information on a computer."--- They looked at the genetic code of the smallest bacteria in the world and sequenced it. Gene sequencing is the process of identifying how the nucleotides are arranged in the DNA of a cell. They copied the code, which are just a series of lettered representation of nucleotides, I will attach a sample picture. As against the baloney our pseudoscientist Sino wrote up there. This is synonymous to looking at the code that was used to produce one OS and use the same code to produce your own OS. Haven't you created a new Computer? Sino is very very dishonest, and at this point, it's becoming a waste of time discussing with someone who is intellectually dishonest.

The genetic code stored in a computer is always like this - ATTCGAGTACTTAAACTATTTGGGCGTACGTAGCTGACAGTACGT

Here is the source again ---- https://www.telegraph.co.uk/news/science/7745868/Scientist-Craig-Venter-creates-life-for-first-time-in-laboratory-sparking-debate-about-playing-god.html

sino:
I had already presumed your response, you guys are easily predictable, and the level of my intelligence is way beyond your likes that read headlines to arrive at spurious conclusions! The real scientists are still very much uncertain about the origin of life, they are yet to prove the origin of life from non living materials, and show the process, but you my friend believe, afterall, according to you, "the truth about science is that it is true, whether anyone accept it or not" Just as any theist would say, the truth about my religion is that it is true, whether you accept it or not!

Oh, there he goes again. The story of how his level of intelligence is greater than ours, and he cannot easily tell a lie when he sees one. How a book sent by invisible angels by invisible Allah beats years of work carried out in the lab is a nice place to hide for an intelligent person like Sino.

From the source again : "Professor Julian Savulescu, an expert in Practical Ethics at the University of Oxford, said: “Venter is creaking open the most profound door in humanity’s history, potentially peeking into its destiny.

"He is going toward the role of a god: creating artificial life that could never have existed naturally."

This is the first synthetic cell that's been made, and we call it synthetic because the cell is totally derived from a synthetic chromosome, made with four bottles of chemicals on a chemical synthesizer, starting with information in a computer(lettered codes)," said Dr Venter.

It is evident that scientists have made it known and even demonstrated that life can be created from chemicals, non living materials. But our intelligent Sino who is also a bogus liar said they haven't. Who would take such a person serious?

Sino, you're very correct that we say science is true whether you believe it or not, you are an evidence of that. If not for science, we won't even be doing this on the internet, would we?
If not for science you will not be struggling to discredit the work of Craig Venter and be misrepresenting it here on Nairaland with sheer dishonesty. You must have faith and fantasy to have such dishonesty. Lol.

However, the only counter explanation you have is that Allah did it, because it was written by an illiterate 1400 years ago. Is that even sensible? Why not just scrutinize this Allah did it excuse as much as you're scrutinizing abiogenesis? Why not provide testable evidence or plausible explanations of how this Allah did it?

On the basis of abiogenesis, there's more plausibility and objectivity than your excuse of Allah. You just want us to accept that Allah did it and not ask questions? But you're quick to throw 100s of questions my way, but I still answered them. You on the other hand would only quote a verse from your trash book either telling us that our knowledge is too small to know or that we shouldn't question Allah. Perhaps your brain is too low to carry the explanations given on abiogenesis too. Lol

But what do we even know sef, sheybi you're the most intelligent.

Attached below is a sample genetic code usually stored in the computer.

MrHighSea:
Make dt kind of a child in some tribes in Nigeria.
SHE/HE WILL EVEN BE STIGMATIZED BY UR FAMILY.
I'm very sure the villagers will stigmatize the child in many tribes.

Fucck tribes bro, it's my life, my child. Who cares about tribes? There are many children born without their parents being married and guess what? They are doing fine.

Splinz:


Whilst sheer thoughts like having little angels run around my house shouting: 'Daddy! Daddy! Daddy!' excites me a lot, I wouldn't be a proud father of such children if I don't marry their mother.

Why? Simple. I don't wanna breed bastards.

So your children are not your children because you didn't do party and put a ring on their mother's finger? You still have a long way to go.

sino:
I often wonder how convenient it is for these supposed atheists to question evidences about God, when they themselves hold on to some sort of faith in their acceptance of scientific hypotheses/theories…

I am almost getting tired responding with the same thing to your mediocre mind. Once again there is no faith being exercised where there is objective evidence. Scientific theories don't need to be believed, they need to be understood!

sino:
Let me bring an example to drive home my point. Our ‘biochemist’ atheist (Akin1212) wants us to believe that abiogenesis is true, he has bragged about the achievements and breakthroughs thus far and how true they are, but quick to acknowledge the difficulty cum unlikelihood of ‘creating’ life from scratch…

So what evidences did Mr. Scientist bring thus far?!

1. Urey-Miller Experiment
2. Synthetic DNA

Ad hominem. Why attribute it to me? Did I ever say I want you to 'believe' anything? If yes, could you please point to where I said that? I have only told you that Abiogenesis is the scientific theory based on series of experiments that have hard facts. Do you even need to believe anything, or are you cursed to believe everything?

In the course of running abiogenesis down your weak mind, I explained many scientific facts and truths, such as what all living things are made up of etc. It's not my fault that you cannot comprehend, Mr.

sino:
It should first be noted that the first has a lot of baggage, one of which is the assumption of the early earth and what it contained, also it still couldn’t account for the complex molecules found in life, not to even mention that the amino acids produced were racemic, and what happened to these amino acids to become 'alive', amongst others…Of course, there are more assumptions to explain away all these baggage

Lol, when you see ignorance, you know it. Are you trying to deceive the lay people by using the word 'alive' as regarding amino acids? I won't even respond to that hysterical baloney. The conditions of the early earth were not assumed. Read more bro

sino:
Secondly, synthetic DNA only shows that there is a need for an intelligent designer, it took the researchers more than 2 decades, of studying, planning, strategizing and experimenting to come up with a synthetic base pair not to also mention the fact that this synthetic base pair cannot do zilch except it is incorporated into already existing DNA and life! Wow! But about 3 billion base pairs found in man are from a random occurrence right?! Oh sorry, it took billions of years of purposeless trial and error to produce the complexity and diversity of life abi?!

Presuppositions again, a design only needs a designer, perhaps a DNA need a DNAer?

The first failure of logic here is to call a DNA a design, throw that babble out the window, please. When you're ready to discuss about the things you have zero knowledge about, we'll discuss it.
You obviously think man is the only living thing on earth. Lol, perhaps you're driven by the egoistic, vaguely purposeful life you're living to think of man alone as the center of all living things? Lwkmd. Wake up bro, it's not about typing grammar and epistles.

sino:
When faced with the obvious reality which would require them to provide observable and reproducible concrete evidences of ‘creating’ artificial life from nonliving materials, the atheist could only but retort, demanding for evidences of how God created man! Well, out goes the scientific method guys….And in comes the faith-based science “the truth about science is that, it is true, whether you accept it or not”

Artificial life is history. I knew you know nothing than to come here and make noise.

https://www.telegraph.co.uk/news/science/7745868/Scientist-Craig-Venter-creates-life-for-first-time-in-laboratory-sparking-debate-about-playing-god.html

You don't even understand how reactions work, talk more of the formation of nucleic acids. You think it takes place in one day? The formation of nucleic acids still take place inside humans and all living things including plants, but only this time it uses enzymes which make the reactions faster. I can't be teaching you biochemistry na, your ignorance is clearly written on the wall. Only if you approach your bold claims of your god existing this way lol. Science does not need to create a life for you to accept the truth, they only need to show processes with concrete evidence. Which have been shown already. But because you're still carrying about your childhood fears and fantasy, your mind is not open enough to accept the facts presented before you. However, how many concrete evidence have you provided for the existence of this your creator?

sino:
Here above, we have the supposed evidences that our scientifically inclined ‘scientist’ atheist uses to believe in abiogenesis as true! When we then tell them that their own existence including the universe and how they function are evidences enough to prove the existence of an intelligent, powerful, all knowing etc. creator called God; they go on a hyperventilating tirade, as if that changes anything

Allah (SWT) Says:

Or were they created by nothing, or were they the creators [of themselves]?
Or did they create the heavens and the earth? Rather, they are not certain.

(Qur'an 52:34-35)

Are the atheists here foolish?! Your guess is as good as mine!

Lol, as usual. Allah said something and wrote it down in a book and sent it to one illiterate in a locality in Arabia Asia, isnt it? You like thinking you're intelligent, but even a 10 year old boy can quickly see how slow your mind is. You have obviously shot yourself in the foot.

While you yourself quoted that I supplied an experiment, synthetic DNA that are both my facts, all you had to show us is that in a trash book, Allah said something, therefore Allah exists.

Go and sit down in a closet and ask yourself countless times if you're making sense at all in the simplest ways possible, ask yourself o.

AbdelKabir:
Look a them, they don't even understand what I'm saying......

Lol, that's because you're not saying anything.

If you can't explain it simple enough, then you're confused. Or perhaps you're saying exactly what we thought.

AbdelKabir:
Good, the correct thing you should've said is "we don't have sufficient equipments to prove the metaphysical world" not "there is no proof" you saying there is no proof is simply a "belief" you are holding on to which you have no proof for, so you are falling into the exact thing you accuse theist of, that they have blind faith. I believe I'm clear enough....

You see, this is why it is advised not to prove a negative because it is a logical crime. If you presuppose that we don't have enough equipments to prove the metaphysical world, you are indirectly saying the metaphysical world exists. But the existence is what we are asking you to prove that you can't. And the existence that we can't prove is only an assumption not a fact. There is no proof of the metaphysical world, the only thing there is proof of is ignorance that leads to the assumption that there is a metaphysical world. When people see a process that they don't understand, as a result of ignorance, they attribute it to the metaphysical. A process that you can't explain is not a proof of the metaphysical world, it's just the proof that you don't know what you're observing.

Saying there is no proof is not a belief, are you confused on the definition of what a belief is? Saying there is no proof is a claim that there is no proof at all for something of which there is zero proof of. You are not clear enough at all as I can see that you have successfully confused yourself into believing that asking for evidence and saying there is no proof of the metaphysical is a belief. Lol, that's very laughable.

usermane:
Ha?! There are breakthroughs, but there is still a long way to go, to be honest. Until the first bacteria DNA is synthesized, there isn't much to consider to be honest. I feel a better alternative to abiogenesis would be that extraterrestrials cooked up man and all earth life in a lab.

If you don't do research but base your faith in old books that were written thousands of years ago, information will always elude you. There is still a long way to go, says who? Are you a researcher? The synthesis of life or a cell is history in the science world, stop deceiving yourself. The emergence of life or complex cell like a bacteria was not a single event, it takes time and special conditions, we don't need to synthesize a new bacteria from scratch for people like you to accept abiogenesis, that's not the aim, and because you want to see it happen does not mean it will be done, else you must also be ready to talk to your God to be ready to send down the manual he also used to create Adam and Eve down to earth too because we also need a plausible hypothetical mechanism of how he did it as you have claimed. The truth about science is that, it is true, whether you accept it or not. That extraterrestrials cooked up man is just another nonsense, prove it.

https://www.independent.co.uk/news/science/artificial-life-synthetic-dna-scientists-living-organisms-create-scripps-research-institute-floyd-a8083966.html

usermane:
No objection on my part. But see, it's not just about me. It's about the billions of theists out there who believe that God has good reasons for letting suffering happen on earth to innocent people. Theists believe God is all wise, and He has good purpose for not stopping evil. Purposes that are best known to him.

And that is why theism is a disease that eats deep into the skull of people right from childhood. Isn't that why they kill themselves for an unproven God? Because billions of people believe something doesn't make it right, does it?

usermane:
No objection on my part. But, like I explained to tinting, you cannot undermine the significance of personal experiences in individual beliefs. And as to evil happening to theists without divine intervention, please do remember that theists do regard these evils as divine punishment or trials from God. Theists believe that God sometimes punishes or test his followers with calamities and misfortunes.

If religion is restricted to individual beliefs then no one will be disturbed. But when it comes to where they will now say those who don't share the belief with them will suffer forever in hell is where we will have problem. Everyone should worship their own god and go to their own heaven or hell. But is that how it is? How come you now said religion is an individual thing?

Theists are basically stupid people, cognitive bias will not let them have peace. Can a loving and merciful God be a punisher? I don't need to overflog this particular issue. You can't be white and also be black at the same time.

AbdelKabir:
May I know the methods you used in concluding that there are no evidences? Or you just sat at one corner of your room and concluded that there are no evidences?

Let's start by defining testable evidence: A testable evidence or proof is or are facts or observations that are presented in support of an assertion or claim.

Also evidence is a body of objectively and not subjectively verifiable facts that are positively indicative of, and/or exclusively concordant with, that one conclusion over another.

Culled from Wikitionary.


Now, let's stop blowing grammar, in lay terms, the evidence I am asking for is an objective evidence that can be seen or felt by everyone irrespective of what you believe, who you are, what you do, how you look, or what you eat, that is independent of having faith in that which evidence is asked for.

For example, if there is evidence for the existence of Allah, everyone should be able to verify these evidence and not just Muslims, and verifying these evidence will not require you to be a Muslim first or believe in Allah first.

If you have these type of testable and verifiable evidence, please drop them. Thanks.

aadoiza:
So for your mind now, I dey fear you. You people no go kill me with your sarcasm.

If you were half a scientist you think you are, by now, you'd see the telltale indolence in your approach to science.

I was actually doing you a world of good but you've exposed yourself of your own volition, again!! And no amount of damage limitation will spare you.

Lol, you are always attacking a straw man. You don't need to make me the argument. I maintain, that I don't need to discover anything before I can discuss science. If you are not lazy in thinking, or perhaps you don't think at all, does that statement mean I will not discover anything or I will not carry out experiments?

Leave my approach to science out of it and tackle the issue, the topic of debate. You are not in the position to comment on my approach to science. Don't make it an issue, you're already unscientific to assume the rights to judge or make comments on how people approach science.

usermane:
But how? No one has been able to demonstrate or abiogenesis. It's an hypothesis at best.

That's not true, please read about the Urey-Miller test. Abiogenesis is already being researched with lots of experiments and breakthroughs being found.

usermane:
I really get your point here, I do. But at least theism promises the raped child divine compensation, atheism promises nothing. If you're wronged unjustly, so be it in atheism. This is not sensible to theists?

But does this divinity have any proof or evidence of existence? It's evil to let people believe it's okay to suffer here on earth because they will enjoy in the hereafter when there's no single evidence of the hereafter. Empty promises are worst than no promises. Atheism won't deceive you, theism does.

usermane:
You should sit among theists and listen to their anecdotes. Listen to them recount how Allah heard their prayers and miraculously enriched them after years in poverty, or how Jesus healed their terminal cancer after months of fasting or how Yahweh continue to protect the Jewish state of Israel despite aggression from the surrounding enemy states.

Lmao . Would I also need to listen to how Zeus answered prayers? Or how Sango killed the adversaries of his worshippers, or how the cow they worship in India gave one of his worshipers a job, or how Baal has been protecting his worshippers, or how I don't worship anything and I'm doing so well?

How life happens to anyone is not a proof that any deity exists. It's life bro, it happens no matter what you worship or what you don't worship.

Or do I also need to listen to how Allah has been neglecting those who worship him in Yemen to be bombed too? How Jesus could not save his worshippers from ikeja cantonment bombing in 2001, or how Sango could not even save our ancestors from being shipped as slaves overseas, or how Zeus has failed to eradicated cancer all these years.

When you learn that life happens no matter what, you'll get the picture.

usermane:
To you I haven't said anything reasonable but I'm sure many theists reading this will agree with me, even though my concern is not necessarily to defend theism. The truth is that atheism, has it flaws as theism does. To some theists, atheism is just like a child abandoning his parents, it is not as rational or empowering as many atheists feel.

Oh, don't judge yourself already bro, you tried but your flaws are very obvious. Atheism does not have any flaw. It is simply a disbelief in claims that cannot be substantiated with evidence. If there is no theism, there will not be atheism. Atheism is not like a child abandoning his parents, any theist who think that is basically stupid. Atheism is like a child growing up from the lies his parents told him. Grown people should act like grown people.

najib632:
"claim you're intelligent bro" - I never said this, you're slandering me. How can I prove it to you when you have made up your mind? I am not claiming that Allah exists, Allah exists I am only inviting to you to seek for more knowledge before jumping into conclusion. I have tried to prove it to you, but you're trying to lock me up in an uncertain place.

How do you know I have made up my mind? I don't make up my mind on anything, well, except faith. And that's because it is illogical and unrealistic. I am open minded to facts and evidence, I am always ready to relearn and unlearn. If you have some, show them. But the physical processes or the existence of man and the world do not prove that your God exists, they are not evidence of a God. Show me real evidence, a picture or something. Stop filling the gap. Faith is not knowledge.

Inviting me? I don't want an invite, I want testable, empirical, observable and practical proof. And quoting the quran is also not a way of proving any God.

najib632:
Why are you emphasizing on the "curse" that you don't believe in? Why would you insult Allah when you know how dare He is the muslims? How would you react when your most beloved one is insulted and made to look stupid? My reaction is only natural.

It's not about the curse, I already told you that the curse won't pass Nairaland. It's about the intent, whoever the prophet was, he's not related to you. If you would curse me because of an Arab who lived many years ago or Allah who still remain unproven till date, you can also kill because of that. And that's extremism. I don't entertain it. No matter how dear Allah is to Muslims, you people can't fight for him if he really exists. When my most beloved ones who can fight for themselves are insulted, I won't make troubles or issue threats, I'll walk away. Your reaction wasn't normal, it's extremism at its best.

najib632:
"If it were to be one on one, you would have gone violent. Which is one of the features of Muslims" -
I didn't start a rant with you online it's now in the physical world I would waste my energy? That's your business though. All the claims of violence you allege against Muslims are false. Muslims never invented terrorism if we did why are we the one's suffering it the most? Why is Isreal not being targeted? Where are the WMD's of Sadam Hussein? Why did the US sponsor the first Modern Jihad group against USSR? why did US betray them? The only time muslims get violent is when you insult the messenger of Allah, it is because of our love for him and the sacrifices he made for us.

You didn't start a rant online doesn't mean you wouldn't have been violent one on one. I don't want to keep dragging this. We both know that Islam is the bedrock of terrorism, no matter how much you try to defend Islam, it doesn't change the facts. There might be peaceful Muslims out there, it still doesn't mean that Islam is free of blame of terrorism. The Muslims being killed are seen as those who have diverted from Islam, so the terrorists kill them to put the others in the right direction. The aim is to create Islamic states or Islamic republic. Isn't it? Stop wailing please.

The only time Muslims get violent, lol. Are you trying to justify Muslims violence? That's funny.

aadoiza:
Apt as ever.
Abeg imagine wetin that one wey quote you a few posts up write. Shamefully asserting that he doesn't need to make new discoveries but only knows how to verify other people's works. Haah!!!! And he's supposed to be a man of logic but his logic doesn't tell him that from all observations made he's a charlatan and an embarrassment to the field of science. What would even happen if all scientists had such a lazy mindset? Well, I presume,
that's more unfathomable logic from our well-informed, enlightened, independent-thinking atheists. Yeah, right.

Why don't you just quote me directly, so I can shed some light on your dumbness. Do I need to make a discovery to be valid when I make my points? You stupidly think researches are just done anyhow? Lmao

The statement I made was related to I and Sino's argument on another thread on a pseudo scientific work, but you ignorantly chipped in your garbage as usual to sound intelligent.
If other people have worked and the works are verified by science, is that such a big deal to you? If I have to make discoveries to be valid, then why are you not a prophet, why don't you hear from God? Why are you killing yourself and wasting time on what an Arab man heard from God thousands of years ago? You always shoot yourself in the foot. If you want to make any point, quote me directly. You're a man, not a sissy.