deept:
@zizytd,

also in your code, after the except you put valueerror, is that necessary?

deept:
thanks @ zizytd

i see what you did using a list. I am just starting on python and this was an exercise on loops and iteration, haven't really explored lists. This exercise took a long time for me to solve but learnt a lot on what not to do. eventually got it right:


while True:
num = input("Enter a number: "
try:
int(num)
except:
print("Invalid input"
continue
num = int(num)
if type(num) == int:
break

largest = num
smallest = num

while True:
num = input("Enter a number: "
if num == 'done':
break
try:
int(num)
except:
print("Invalid input"
continue
num = int(num)
if num > largest:
largest = num
elif num < smallest:
smallest = num
print(f"Maximum is {largest}"
print(f"Minimum is {smallest}"

def min_max():
    list_number = []
    while True:
        num = input("Please Enter a number: " )
        if num == "done":
            break
        else:
            try:
                list_number.append(int(num))
            except ValueError:
                print("Invalid input" )
    print(f"Maximum is {max(list_number)}" )
    print(f"Minimum is {min(list_number)}" )

deept:
Hello guys,

could you help look at the code; this is what i'm trying to achieve but not quite getting the output desired

Write a program that repeatedly prompts a user for integer numbers until the user enters 'done'. Once 'done' is entered, print out the largest and smallest of the numbers. If the user enters anything other than a valid number catch it with a try/except and put out an appropriate message and ignore the number. Enter 7, 2, bob, 10, and 4 and match the output below.
Desired Output
Invalid input
Maximum is 10
Minimum is 2


num = input("Enter a number: "
largest = num
smallest = num
while True:
num = input("Enter a number: "

if num == "done":
break

try:
int(num)
except:
print("Invalid input"
continue

if largest < num:
largest = num
elif smallest > num:
smallest = num

#print(num)

print(f"Maximum is {largest}"
print(f"Minimum is {smallest}"

Carstuff:
Hello guys. Is it true Python is optimized for data science?? Can it be comfortably used as a back end scripting language rather than say PHP??

peacettw:


Perfect. Thanks a whole lot. Seems that I have so much to learn.

Is there like a community of python coders in Nigeria that I can join?

peacettw:
Never mind, I have figured it out

dna = "CCTGTATGCCCAAGGGGTTTCGATCGTACGACTGTCAGTCAGCTAGCT"

l=list()
n= len(dna)/3
count=0

print(dna, "\n" )
while n>0:
j=dna[count:count+3]
count = count + 3
n= n - 1
l.append(j)
print(j)
print(l)

Excallibur:
please bosses in the house familiar with pydroid 3 help!! I've been trying to upgrade my pip and this is what I keep getting

Ejadike:
Bro, I greet you. Please what's the name of your school? Are you in scholarship? If yes can I apply as an HND holder for Masters or PGD? If no, what do I need to enroll? Thanks G.

MrBrownJay1:


thanks bro, almost fell for this BS!!!! here is him today....

Mirastones:


Congratulations
Go n succeed

Darrysindick:
Please guru in the house I need your expert input,

My interview is on the 9th of February and enrollment deadline is 28th of February, school resumes 1st of April..do u need to apply for an enrollment extension?

How many courier envelopes do I need to buy sirs and ma'am?

Litolysis:
No I have not tried booking. I am asking if I can go ahead to book appointment and later come back to complete the Blocked account processes. Do I need Blocked account information in other to book appointment online?

Litolysis:
House please help a brother ooo this Fintiba Photo verification is giving me tough time ooo. Meaning am not done with the Blocked Account opening since few days now. I need urgent help please ooo. Can I go ahead to book interview date then later complete the Blocked account thing. Help a Brother please oooo

Perky89:


Yes oh

Perky89:


Yes oh

Perky89:


I don't think TU Berlin requires English test. I'm just waiting for their application period to start. Still looking for the start date though.

Perky89:


TUM, Koln, Passau, Paderborn, and Kiel. Still waiting for TU Berlin too

Perky89:


Yes oo, i applied to 5 schools. Kiel is even my least choice

Perky89:


I didn’t notice, and I’ve sent my documents to uni assist already.

Perky89:


Yea, I have

Perky89:


Yea me too, got admission into the same course, but they didn't agree to defer the admission. I applied late though.

I think someone said earlier that he was able to defer his, not sure of the course though?

Perky89:


Yes

Perky89:


Msc information engineering

Shrekyfiona:
Hiya People.
I need ur urgent advice

I currently work with Stanbic Ibtc bank and earn 120k monthly(did not join as a graduate trainee), the bank is an amazing bank, so much respect for each other irrespective of rank and has the world best work environment (as far as am concerned) with great work-life balance.
Recently, am undergoing Access bank's graduate trainee recruitment exercise and am currently awaiting the TMI(Top mgt interview).
I have read lots of reviews abt Access bank and they are quite scary and crazy. The reviews painted the work environment and work-life balance black but I always try to convince myself that I wouldn't have such ugly experiences.
Now guys, am in dire need of ur advise. I plan quitting Stanbic for Access bank cos of the salary(heard Access pays 249+, yes am aware of the crazy bond) I also feel am gonna have an amazing experience joining as a graduate trainee and it will also mean me starting off nice am will be duly exposed positively but I don't know what awaits me there. I know training school awaits me though but am not scared of it, at the same time am not Einstein.
.Juxtaposing: Stanbic increases/ reviews salary annually according to performance, promotion is fair and transparent. Has unquestionable integrity, am currently doing my M.sc online at the university of south Wales and got a recommendation letter from my HR to the school, am so much at home with Stanbic but I really want to try something new and amazing


Dear Nairalanders and fellow bankers in the house, pls pls pls I beg you, kindly help a soul and guide me against making a mistake I might forever regret.

I don't want to ask for advise from colleagues as am still keeping my plans low and wouldn't want to shot myself in the foot.

NB: Am 24 and have worked in Stanbic for a year plus

DreManuel:


I disagree, albeit your honest opinion. The words are advanced vocabularies and there is nothing foreign about them. The major controversy is the alleged leakage of questions and technical issues as per subject tests. But I think its rather late. The list should be finalized by now awaiting publication.

DMainMan:


after d PhD interview. All results of PhD and MSc will b scrutinized further as PTDF are looking for cheap option though many people will get their choice. PhD interview will end today and results of d previous days has already been decided. PhD and MSc successful lists is usually released together.

Expect the list of successfuls latest first to second week of August. If selected, ensure u have international passport and admission for September entry. Those who need ATAS Certificate should apply for ATAS as soon as possible. U don't need scholarship confirmation.

pompido:
Admission letters have been distributed at least 2 weeks ago. I will advise you email the international center and ask for the status of your application and if possible give you an email address to get a soft copy of the admission letter so you can proceed with visa application.

I know 2 people that already got theirs and we had to go to the office to push for it because they said they stopped sending soft copies and only send the original admission letter. The con of that is you have no clue if you got admitted or not because there is no portal for that.

So email them to first check your status and then try and force out a soft copy from them.

Cheers

P. S: I can't seem to reply new pm. Yahoo always says failure delivery to the Nairaland email address. Am I missing anything?