₦airaland Forum

Welcome, Guest: RegisterLoginWith GoogleTrendingRecentNew

Stats: 3,326,121 members, 8,425,062 topics. Date: Friday, 12 June 2026 at 04:35 AM

Toggle theme

Sino's Posts

Nairaland ForumSino's ProfileSino's Posts

1 2 3 4 5 6 7 8 9 10 (of 71 pages)

IslamRe: The Problem With Allah's Plan by sino(m): 10:16pm On Mar 20, 2019
tintingz:
Is God not the planner of destiny, are my choices out of God's plan?

God knows exactly your end which you can't escape, e.g he knows you will fall into consequence B no matter what, what then is the purpose of testing, for you to change your mind or what?

My hand work is useless as long as my end as already been destined by God.

People are tested to know their decisions not that they already know their decisions!, that's the purpose of testing, the person that organized the test is not perfect.

Are you not seeing the paradox in your argument?
Lol, You are seriously confused. If people are tested to know their decisions, why are you now arguing about knowing your decisions?! I have informed you that the test is not for God but for you! Your hand work will show you that you deserve your destiny, since it would be your hand work and nobody else! The tests shows your decisions, your choices, they are evidences for you or against you! There is no paradox here, except the one you have initiated for yourself with your line of reasoning!
IslamRe: Challenge Of The Quran : Produce The Like Of This Quran by sino(m): 10:04pm On Mar 20, 2019
tintingz:
Lol, that's the absurdity of the Quran not providing parameters for the challenge.

It's actually a brilliant poetry with the Quranic style, forget about the funny stuff, it's a parody. He can actually write a well serious one, he's working on the project.

Like I said before, Muslims will never admit one got the challenge right even if you write a very intelligent one, that's the absurdity pointed out in the "Surah Faa Qaaf".
Brilliant?! SMH, I am sure you have never read any classical Arabic poetry in your life! What parameters are you looking for? Do yourself a favour, bring the verses of the Qur'an and compare with the above and show me the brilliance of the above, in what way is it brilliant?!

Why not write your own and let us see afterall you claim the Qur'an was poorly written or you cant write your own?
IslamRe: The Problem With Allah's Plan by sino(m): 9:50pm On Mar 20, 2019
tintingz:
You are still not getting the main question.

Does God knows this is what will be the end of you long before you were born? No matter your choice, test, warning, does God already know the end of it?

God doesn't need to ask or wait for you to choose when he already knows your end, he's even the planner.

If God wait for you to choose before knowing your end then he's not all-knowing therefore not a perfect God. Testing someone is an attribute of Imperfection.

To make it more easier,

If there is consequence A and consequence B spelled out, did God long before you were created/born knows the exact consequence you will fall into?
God knows exactly your end and it is predicated on your choices! That is why you have a choice and free to choose either of consequence A or B. Your choices would definitely align with either of the available consequences!

The issue that should concern you the most is how to make the right choices! I have given you the reason for the tests, and it has nothing to do with imperfection! When you see the work you had sent forth, you will have no one to blame except yourself, because it is your "hand work" !
IslamRe: Challenge Of The Quran : Produce The Like Of This Quran by sino(m): 9:10pm On Mar 20, 2019
tintingz:
Does the prophet here meet the parameters? cheesy


>> https://www.nairaland.com/5084338/challenge-quran-produce-like-quran#76836188
O ma se o! Are you admitting that you can't take up the challenge after your bragging?!

I can only compare the above with Lasisielenu's skit on poetry is not dead, you may search for it on youtube. I know it is an attempt at parody, even with my elementary knowledge of Arabic poetry, the above is pathetically pathetic, it can't even be classed as poetry and it made zero sense, just read the translation you provided! Even with the poor attempt at recitation like the Qur'an, it sounds off and awkward!

It is better you admit that you cannot produce the likeness of the Qur'an than exposing your tomfoolery!
IslamRe: The Problem With Allah's Plan by sino(m): 8:49pm On Mar 20, 2019
tintingz:
- The believe in hell where people will be punished for eternity does not depict a merciful God!

- Before you were born Allah already planned and knows your end, no matter your choices it's part of Allah's plan and destined, testing is meaningless, if he test then Allah must be either imperfect or malevolent in this case.

- If God knows all my choices beforehand then he already knows what to judge me, if he ask me to choose and then change his mind concerning my prior choice then he's not all-knowing therefore he's not perfect!
All the above hasn't shown the imperfection of God you claim. The fact that God knows your choice and still asks you to choose has no correlation with imperfection in any way!

You can either choose to believe or disbelieve, there is no third option, and the consequences are already spelt out for all! So there is no hidden knowledge of your choices cos you can't choose beyond the choices available to you!

The meaning of the tests and your freewill to choose are evident in the fact that no one is forcing you to do anything, and when the time comes, and your records are brought before you, you will understand that it was all you, you did all these online and offline by yourself, and only you is responsible and shall face the consequences! It is like a student who fails and started ranting that the lecturer hates him, his paper was called, and he was shown what he had written to be nonsense! If the student hadn't been shown his handwritten nonsense, he would keep peddling the lie that the lecturer hated him!
IslamRe: Challenge Of The Quran : Produce The Like Of This Quran by sino(m): 8:13pm On Mar 20, 2019
tintingz:
Does the Quran itself mention any parameters? Anybody can formulate anything.

Even if someone meet the Quran challenge, Muslims will still say one didn't meet the challenge.

Watched the first video, the dude was using myth to confirm his claims. That's ridiculous.

Video no. 2, the Quran is outdated, many practice in the Quran compared to today reasoning.

Video no 3, the Quran was written, it's a man-made book, there's nothing divine about it.

I didn't bother watching the rest, many flaws in the ones I watched.

Some other Muslim sects disagree Muhammad was an illiterate.

This one Is long. Will create time to watch this.

The claims here are jokes.


What's this? undecided

The Quran did not mention any parameters, the OP videos are examples of the absurdity of the challenge.
I thought you were bragging that the Qur'an was poorly written, why all these myriad of excuses? It shouldn't be that difficult for such an intelligent and sophisticated person like you to make your own Qur'an na... Please get to work, we have the Qur'an, so that is your parameter, we shall be here to compare whatever you can write with what is available in the Qur'an, it is as simple as that....time is ticking...
IslamRe: The Problem With Allah's Plan by sino(m): 2:08pm On Mar 20, 2019
tintingz:
Ok, using the video game analogy, if you have powers and you know the future and planned all, won't you know outcome the of every tasks in the game, what's the essence of playing the game when you know the outcome, are you just playing for fun?

That's how God is he know every end of everyone yet he test people for fun.

We play games to learn new things, we're curious to know what happen next.

It's only someone who's imperfect and doesn't know all that test people to know their choices.
First of all, Allah had said he didn't create us for fun/game! rather Allah created us to worship Him! I'm sure the brother that used game as an analogy was only trying to make you understand some aspects of divine knowledge and decree! But regardless, even if for argument sake, that this world is a kinda game for God, unfortunately for you, it isn't a game cos you are the one at the receiving end. And no matter how you rant, wail, cry, deny, abuse, mock, curse, etc. You are still at the mercy of this God you love to hate! Until you understand that tests are meant for us, and not God, and that God having the knowledge of your choice and still asks you to choose on your own, can never be equated to mean God is imperfect! What sort of logic is that sef?!

I know instead of you to pause and reflect, you would come up with more denials and rants, and as I always say, that changes nothing!
IslamRe: Challenge Of The Quran : Produce The Like Of This Quran by sino(m): 1:40pm On Mar 20, 2019
lanrexlan:
There's nothing worthy of attacking in your personality. Truth is just bitter. I still maintain my stance on what I said. Only empty korodom makes some much noise. A person that barely understands Arabic and doesn't even have foundational knowledge of science wanna write a scientific and rational book to challenge the Quran!!! Pathetic and ridiculous!!!

I have been laughing since I read that post of yours grin grin
This dude doesn't know what it takes to write a book sha

But if the bragging and self-professed knowledge joined with pride do make you sleep better at night, then enjoy your imaginary world of knowledge. grin


**unfollows thread**
Do you know what is actually ridiculous is the fact that tintingz is asking for parameters for the challenge when the book, the history of how the book came to be, and the preponderance of the book with regards to the book's impact, are everywhere!

tintingz, you may wish to peruse the following links, and when you are through, and ready to take up the challenge, I will be here to read whatever you can come up with....

https://www.nairaland.com/914083/quran-work-art-subjective-unanimous

https://www.nairaland.com/818668/why-quran-must-god

https://www.nairaland.com/919181/brilliance-book

https://www.nairaland.com/855448/gems-quran

https://medium.com/@Marytn/the-challenge-of-the-quran-dr-philips-fb00e8951153

It is not enough to come on here and make foolish boasts, since you can do better, write your own book (or whatever) that can compete with the Qur'an! Your time starts now, good luck!
IslamRe: Atheism Is Foolishness? by sino(m): 9:57am On Feb 18, 2019
aadoiza:
Thank you very much Mr sino, for cutting these charlatans to size.
It has been established here that things don't just come to life either by accident or when they simply feel like it, but only do so by a methodic, careful, and well thought-out process. The simple fact that it takes so much time and painstaking efforts and the use advanced technology and ultimately intelligence to do so in a controlled environment (laboratory) very much lends credence to this. As a result, rather than the no-God believers honourably admitting to this one universal truth, they're shamelessly shifting the goal post to "the creator must have been imperfect" drivel.
They thought they could bamboozle us with their quarter knowledge of abiogenesis but got exposed in their botched attempt.
Thank you again, Mr sino.
You are welcome bro, I had already said these ones here are never interested in the truth, they are parochial in their thought processes and very dishonest, even to themselves! Instead of providing the empirical evidence requested, and answer the questions posed, they are falling over each other, with even more foolish and ridiculous responses...
IslamRe: Atheism Is Foolishness? by sino(m): 9:38am On Feb 15, 2019
Akin1212:
Lol, the genetic fallacy and appeal to authority fallacy. When a fact is ignored by attacking its source and appeal to the source of the argument, why can't it come from Wikipedia? You don't have to practise all types of fallacies before we know that you don't have sense.

In my quoted post, the word reference was bolden to specify the reference that was given where I took the statement from. Like I have maintained, the content is what matters and not the source. I even did not include the source, instead I used the research that was referenced which shows honesty. Why are you crying? cheesy.

After making empty boasts that you have access to paid journals, you couldn't look for the journal and read if it follows the statement or not? Discrediting Wikipedia does not serve any purpose, grow up abeg.

Anyway, I read the journal already, if you want to learn, use your self acclaimed access to journals to search for it and read it to understand the research, I doubt if you will understand it sef. grin

I didn't reference Wikipedia's link, I referenced the journal that supported the Wikipedia statement, know the difference and stop showing us how fallacious you can be.

The question is, is artificial gene synthesis with great efficiency possible? Yes it is, very possible, in fact. Read the journal.
If you truly have the journal, why not quote directly from it instead of quoting from wiki?! Why didn't you acknowledge that your quote is from wiki?! So there is a difference between source and reference abi? I am sure this is how you did your project, dubiously copying from wiki and taking the reference from wiki page without even reading and understanding the contents of the article. There is no fallacy on my part, and I addressed the contents of your quote which you didn't respond to.

Do you know what a DNA aptamer is?! Your referenced journal is talking about generation of an aptamer, and we are talking about gene synthesis and by extension a whole genome! I presented facts about this process being problematic as you would require specific large sequence of DNA, but the process of synthesizing DNA sequence can only make short sequences of oligonucleotides with optimal yield...

There is no known practical method of synthesizing a gene and a whole genome except for the procedure I had explained previously, if the solid-phase synthesis of DNA can only synthesize short sequence oligonucleotide, how then can they synthesize a whole gene?! Explain, bring evidences from your referenced journal that you have read already (with snapshots), stop deflecting and show everyone that you truly understand the methodology!

If I was only focused on your ignorance and dishonesty, I wouldn't have mentioned the facts that you cannot disprove from the same wiki link you couldn't reference in the first place! I would present the snapshot of the journal, then you should do same of where the journal is talking about artificial gene synthesis...

Akin1212:
All your insults and personal attacks are not evidence that supports your claims, they are just useless ad hominems. If you like don't even respond to the rest of what I wrote, that's your cup of tea. Your response or not does not change facts, not in this world or the next.

Meanwhile, you have failed vigorously to provide a peer reviewed paper, factual, realistic, hypothetical mechanism of how life started on earth, that serves as an alternative to abiogenesis, that is testable and universally true.

You must be a joke Sino, for dragging me through your petitio principii(circular argument). You actually have nothing to offer. If your access to paid and free journal does not suffice to get this particular journal, answer the question I asked above and I shall gladly send you a snapshot. grin
grin grin grin You are a lousy ignoramus!

Your wiki source supports my claim of the difficulty in synthesizing artificial gene not to even talk of the genome, since you have to start from synthesizing the DNA sequence in a gene which can be more that 1000 bp and in humans, they can be up to 2 million base pairs! But only 200bp can be made with sufficient quality. This is what you believe came together randomly by chance without intelligence, yet to make a sequence of more than 200bp by the supposed intelligent scientists with all the advantages at their disposal, is a daunting task!

If only you know the implication of this gaffe you made above in the academia, you wouldn't even write this pathetic response as a defense of your outright dishonesty! This is not an ad hominem, this is establishing your ignorance and academic dishonesty! If you cannot understand what can be found on wikipedia, and you are dishonest about the reference, then how can anyone take anything you say as having any resemblance to science and by extension the truth?! As I always remind you, the thread isn't about proving the existence of Allah (SWT), but rather to expose atheist like you as being foolish, and here you have repeatedly exhibited extreme forms of foolishness!

IslamRe: Atheism Is Foolishness? by sino(m): 4:33pm On Feb 14, 2019
Akin1212:
The synthesis of oligonucleotides is non sequitur. It does not in anyway change the fact that synthetic chemicals gave rise to a synthetic genome which maintained and perpetuated life of a cell. The origin of life due to the theory of abiogenesis was not a simple process, neither was it a single event. The fact that it took up 300 million years for life to arise from simple organic chemicals means it is a very difficult process. Perhaps, you think because it is random, hence it is straightforward. I would be disappointed if that's what you think, with all the intelligence you have boasted of?

Abiogenesis gave rise to simple life forms and not complex life forms. I'm beginning to think you're just blindly replying me and not reading. Life evolved to the complexity we have today.

Venter and his team used yeast cell to assemble the synthetic genome. There is no joke there, they could have done it in vitro and still have the same genome, but using yeast did not make the molecule of life that was synthesized less synthetic, it still remained 100% synthetic. Don't do strawman, my friend.

First of all, there are physical laws. Laws that were present from the primitive earth to modern earth. The primitive earth was not all chaotic as you're presuming. And in 300 millions years, with these physical laws, with the way atoms and molecules bind with themselves, yes complex molecules can emerge. They actually did. You're misrepresenting science Sino, I know it's because you don't understand it.

For the above, where you said scientist can only synthesize 60 bases with 75% efficiency, you lied and misrepresented science once again. The following proved that.

"Artificial gene synthesis, sometimes known as DNA printing is a method in synthetic biology that is used to create artificial genes in the laboratory. Based on solid-phase DNA synthesis, it differs from molecular cloning and polymerase chain reaction (PCR) in that it does not have to begin with preexisting DNA sequences. Therefore, it is possible to make a completely synthetic double-stranded DNA molecule with no apparent limits on either nucleotide sequence or size. The method has been used to generate functional bacterial or yeast chromosomes containing approximately one million base pairs. Creating novel nucleobase pairs in addition to the two base pairs in nature could greatly expand the genetic code."

Reference: Kimoto, M.; et al. (2013). "Generation of high-affinity DNA aptamers using an expanded genetic alphabet". Nat. Biotechnol. 31 (5): 453–457. doi:10.1038/nbt.2556. PMID 23563318.
This above is the height of dishonesty! Can you present the snapshot of the quoted in your reference you presented for everyone to see? You searched on google for "artificial gene synthesis", you quoted wiki, and used the second reference on wiki, thinking that it contains the same information as what is on wiki?! As I said, you are an empty korodom, making noise all over the place, you can only deceive the likes of you with this nonsense!

For your information, even from the wiki link you dishonestly referenced and copied from,

"The longer the oligonucleotide sequence that is being synthesized, the more defects there are, thus this process is only practical for producing short sequences of nucleotides. The current practical limit is about 200 bp (base pairs) for an oligonucleotide with sufficient quality to be used directly for a biological application."

https://en.wikipedia.org/wiki/Artificial_gene_synthesis

How is this different from what I had written?! Where is my lie?!

You are very pathetic! You and biochemistry or even science should never be in the same sentence again!

Akin1212:
They had to make a minimal genome which can functionally maintain and perpetuate life to show that all that is needed for life are chemicals. They did that and it worked. They don't need to make the whole genome of the naturally found bacteria which also contains JUNK DNA. We already talked about this. So, they made a minimal genome to eliminate useless DNA. It still doesn't change the fact that the genome synthesized was completely synthetic.

The advanced technology, what is the advanced technology?
Do you know the PCR is an in vitro process? Polymerase chain reaction is done in the lab. Polymerase chain reaction is more than enough to generate millions of segments of a DNA, how much more thousands?

"Polymerase chain reaction (PCR) is a method widely used in molecular biology to make many copies of a specific DNA segment. Using PCR, a single copy (or more) of a DNA sequence is exponentially amplified to generate thousands to millions of more copies of that particular DNA segment. PCR is now a common and often indispensable technique used in medical laboratory and clinical laboratory research for a broad variety of applications including biomedical research and criminal forensics . PCR was developed by Kary Mullis"

The yeast cell doesn't do anything special other than what PCR does. It's the same principles. Stop making ot look like someone planned existence. Lol

Venter and his team had many options to assemble the DNA other than what they used as specified above, such as DNA printing, let's be guided please. You're not helping anybody by posting lies here.



Life started simply not as a complex assemblage. In the formation DNA synthesis and and assemblage of simple chemicals which make up the bases, there are natural laws that guide hot atoms and molecules interact. With these natural laws, 300 million years and favorable conditions, a lot can happen. Life happened.



They could have not depended on the living organism and still made the synthetic DNA still. Which means that to create life, you don't need life. And that's exactly what abiogenesis is sayimg.



Was the natural genome left in the bacteria cell? Remember the research papers cell they created a genome and labeled or watermarked it to differentiate it from the natural genome. And that after putting the synthetic genome in a cell, the cell was able to carry out all the processes of life. No arguments here.

I have defined life many times here, a series of process that includes needed metabolism. The genome codes for this processes. The synthetic genome carries information of life processes. It can do everything the natural genome can do, and what the natural genome can't do, it also can't do. A cell is dead without its genome, which resides in the nucleus as DNA.

Venter DNA didn't need life to function, they only opted to use a living cell for assemblage of the DNA, the living cell didn't didn't add life to the genome. It only helped to arrange it, and this could also be done in the laboratory.



Venter's research once again was aimed at creating a synthetic genome that was able to maintain and perpetuate life from a mix of synthetic chemicals. This is very clear. It's not about what people like me want, it's about what happened and what was done successfully. On the other hand, people like you who argues for and believe in an unproven, non existent intelligence find it hard to accept because it eliminates this intelligence.

Venter genome did not come from any organism or cell, it was distinctively made from synthetic chemicals. They only used living systems to assemble the DNA and this could have been done by other means. Stop trying tonmake it look like they needed life to make the synthetic genome.

Whatever perpetuates life, also gives life. The synthetic genome continued the function of the natural genome. It contained the information necessary to make life continues. It is still supplying life to the cell. How hard is this to understand?

It is real science and it has been explained over and over again. I don't need to believe it because I can also reproduce the research and see for myself. Unlike tou who Allah cannot speak to, he could only speak to Mohammed and hence he is quiet until you die.

Again, you are the one whi has been avoiding the same question I have asked over and over again.

Now that you have claimed that a creator exist, can you give us a peer reviewed paper, factual, realistic, hypothetical mechanism of how life started on earth, that serves as an alternative to abiogenesis, that is testable and universally true?
All the rest of what you have written would only be responded to when you present the snapshot I requested above, else, you just confirm that you know next to nothing about science and its methods, you are just a believer in what scientists say, without even understanding it!
IslamRe: Atheism Is Foolishness? by sino(m):
Akin1212:
Do you even understand why the yeast cell was used? Lol, you will not kill me with laughter. The yeast cell was used for genome assembly. This could have been done in vitro, but it would cost money and time, hence the use of the yeast. Let me quickly address your Baloneys again.
If it is difficult for man with all the intelligence, knowledge and advancement to synthesize 100 oligonucleotide bases in the lab, and therefore making the process of synthesizing a gene more complicated and synthesizing a whole genome even more complex and with greater difficulty, so that they had to depend on a living organism, then the joke is on you! The proposed minimal genome for life will require 256 genes, and each gene may have up to 1000 or even higher base pairs. Scientist can only mange to synthesize just 60 bases with about 75% efficiency, anything greater than that would be problematic, but you believe that these chemicals were just randomly formed by chance in a primitive and chaotic environment without any form of intelligence!

Akin1212:
1. They got synthetic chemicals and used it to synthesize a synthetic genome. Which was the theme of the research.
The theme of the research was to make a minimal genome for a living cell functionality.

Akin1212:
2. They used advanced technology, because without it, the research would have costed more money and time.
The advanced technology couldn't make more than few bases which is a single strand, after which they have to make a complementary strand, then use enzymes found in living organism to assemble these oligonucleotides using PCR, then another living organism (E. coli) is used to clone, and then sequencing is done for verification, these processes are repeated till the sequence for a single gene is made, this is called a gene cassette. And we are going to 473 genes! The yeast cell does the remaining job in assembling the cassettes and cloning...Then testing again by a living organism!

To achieve their goal without depending on these living organism and their enzymes, Venter and his team had no other option other than the above method! This is not a money or time issue, but the only realistic and practical methodology available!

Akin1212:
3. The conditions of the early earth or primitive earth is different from the one we have now and it has been established.
Of course, you should explain how feasible these simple chemicals came together to make such a very complex assemblage to begin life, if after the favourable conditions we now have, and the advanced technologies, how could this unintelligent process 'knew' how to assemble in the right configurations for optimal functionality?!

Akin1212:
4. They used bacteria cell to check for errors in the 'synthetic or artificial genome' they created. This doesn't make the genome natural, it was still artificial.
Who is saying that it is natural?! I said for them to have created a synthetic genome, they depended on living organism, for the synthetic genome to work they depended on a living organism, these then proves that to make life, you need life! And this is not what abiogenesis is saying!

Akin1212:
5. They removed the natural genome from the bacterial cell and put the artificial genome, the artifical genome was able to do what the natural genome was doing. Which is the maintenance and perpetuation of life.

6. Abiogenesis is the theory of how life arose from simple organic chemicals or compounds.
Can you kindly explain how they removed the natural genome from the living bacterial cell?! And the question you keep running away from, Is the genome a living entity on its own or contains information for a living entity? What can the synthetic genome do on its own?! If abiogenesis is defined as how life arose from simple organic compounds, why did Venter's synthetic genome need life before it could function? Did the primitive organic compounds also needed life to function like that of Venter and his team?!

Akin1212:
Conclusion: The basics of the research carried out by Craig Venter and his team was the creation of synthetic genome from scratch using synthetic chemicals. How they assembled the genome, and how they checked for errors didn't make the genome any less synthetic, after checking errors with a bacteria cell and assembling with a yeast cell, the genome was still 100% synthetic or artificial. Their research was to prove that life arose from simple organic molecules, and it was successful, this proves abiogenesis to be true. Craig Venter might have studied the genome of the bacteria they were trying to create its genome, the aim was to show that life arose from chemicals and not any intelligence. Guess what? They did it successfully, this eliminates the God factor.


So far, the research of Craig Venter has shown that life arose from organic molecules. Your denial cannot change that. I understand though that you are so hung up to your indoctrination and hence will reject scientific research or theories based on facts. That there is a creator of life is not a universal truth. It is your thought and your fantasy, because you cannot understand the principle of abiogenesis doesn't make creation a truth. It is nothing but a bold claim.

If you were to be a thinking man, you'd sit for a minute and think if an intelligent creator would create bacteria or other parasitc organisms at all? Or you don't know the biological importance of bacteria and microorganisms?

Now that you have claimed that a creator exist, can you give us a peer reviewed paper, factual, realistic, hypothetical mechanism of how life started on earth, that serves as an alternative to abiogenesis, that is testable and universally true?
Venter's research was not aimed at proving abiogenesis, it is people like you that wants to believe it is, you should provide references from the original research article so that you can prove me wrong! If you believe this research proves abiogenesis to be true, then it means the natural genome that was randomly formed in the primitive earth must have needed an already living cell too! And where would the cell come from?! I have repeatedly shown how Venter heavily depended on living organisms, to create a minimal synthetic genome, you yourself had acknowledged that the synthetic genome maintained and perpetuate life, but not create life, there is a huge difference my friend, and until you can prove how this nonliving chemicals actually started (created) life (which is abiogenesis), you are just being fanatical about your beliefs, just like any other religious fanatic! If it is real science, the data does not support abiogenesis, but if it is belief, then you are free to believe whatever you want!
IslamRe: Atheism Is Foolishness? by sino(m): 10:49am On Feb 14, 2019
aadoiza:
This is impressive, sino. This just about summarises the whole shebang. Non-living chemicals don't just come alive without direction by intelligence. He's just proven that for us
The guy is in a habit of shooting himself in the foot. And he's done it again. If he's a quarter as smart as he thinks he will have seen his numerous gaffes in his equally numerous comments on here.
I admire your patience, bro.
It is so funny how these guys can be so dogmatic, imagine a whole research that did not in any way talk about abiogenesis, is what Mr. Biochemist wants to hold on to has evidence, even after showing that the research depended on intelligence and life all through! But what can I say....

Thanks bro, one needs such when dealing with these set of 'evangelical' atheist... cheesy
IslamRe: Atheism Is Foolishness? by sino(m): 2:25pm On Feb 13, 2019
tintingz:
What a hypocritical, bias, illogical argument from the Quran.

So the Quran believe we were not created by nothing but believe we were created from nothing? This is highly fallacious!
From the prepositions used, you would have seen the difference in the statements, I believe someone had already explained contextually the meaning of "from nothing" to you?!

tintingz:
"Were they the creator of themselves?" The Quran is telling us something cannot exist without a creator, we then need to ask who created Allah?
I have already explained this to you before, Allah is beyond His creation, Allah (SWT) isn't part of His creation, and thus asking such a question is redundant.

tintingz:
If you said Allah has no creator and exist himself or has been existing then you have violate the logical argument "everything must have a creator" we can use same argument for the universe that it exist itself or has been existing.
But we do not believe that Allah (SWT) is part of the universe, and as pointed out above, questioning who created what cannot be said to be part of our universe is redundant, since you cannot even fathom what is beyond the universe, and there is no empirical evidence that suggests that the universe had no beginning!
IslamRe: Atheism Is Foolishness? by sino(m): 1:55pm On Feb 13, 2019
Akin1212:
A theory or hypothesis that is backed by experiments is not to be believed. Craig Venter and his team created a genome from a mix of chemicals that can maintain and perpetuate life. That alone demonstrated the creation of life from chemicals. That's abiogenesis. It doesn't need faith to be accepted, I have said all I needed to say about that. Now it's your turn to give us observable evidence like abiogenesis presented.

Is this the factual, realistic, hypothetical mechanism of how life started on earth, that serves as an alternative to abiogenesis, that is testable and universally true? Allah and quranic verses? grin
Venter and his team, had to use living organisms to achieve their goal. They had intelligence, they had a plan and they had the advantage of advanced technology and favourable conditions which can not be said to be same in the primitive earth. Yet, to make a genome, they depended on a living yeast cell, then a living bacterial cell to check the genome for errors, and then transplant the tested genome into another living bacterial cell! This proves that life is actually needed to make another life! What Venter and his team did is not abiogenesis!

You need not be informed how a computer was invented before you believe that it was, and it would be foolish of you even if you do not understand the processes and mechanism of how it was invented to start arguing that it came to be by random chance. So far, the experiments you hold on to are quite showing the impossibility of these nonliving chemicals to just come together by chance and become a living organism, without any intelligence directing it so as to reach the level of complexity we now have, especially in man. That there is a creator of life is quite simple to understand and believe, and it is a universal truth!
IslamRe: Atheism Is Foolishness? by sino(m): 10:33am On Feb 13, 2019
Akin1212:
I have said all I needed to say about abiogenesis, accept it or not! Your choice. I'm done with going back and forth with an unrepentant ignorant fellow who does not want to learn.

Give us a factual, realistic, hypothetical mechanism of how life started on earth, that serves as an alternative to abiogenesis, that is testable and universally true. We are waiting...
You are the one in need of serious learning! Science isn't based on blind faith as you have continuously demonstrated here, it is based on real and observable data! When there are loads of assumptions in an hypothesis or there are several hypothetical models to explain one phenomenon, and there happens to be no consensus as these models are trying to explain abiogenesis in divergent ways, and the experiments that aims at proving these hypotheses are either unrealistic, have failed or have valid scientific objections, then it is unlikely to be provable and thus cannot be said to be scientific. But by all means, you can have faith that abiogenesis is true, since you said "the truth about science is that it is true"...Even without empirical evidences.... grin grin grin

You can choose to accept there is a creator or there isn't, but the evidences you seek are right in front of you, and as you have faith in science, I also have this strong faith that in the nearest future, the undeniable evidence would be shown to you...

Might I remind you again that the thread is about the foolishness of atheism, and by all means, you have demonstrated this to be true, especially for you, as your 'believe' in abiogenesis to support your atheism does not have the supporting empirical evidences from a scientific point of view!

"B. Chemical Evolution

In the remainder of this section, we describe the most widely favored scenario for the origin of life.Keep in mind, however, that there are valid scientific objections to this scenario as well as to the several others that have been seriously entertained, so that we are far from certain as to how life arose." (Biochemistry, Voet & Voet)

Allah (SWT), The Creator Says:

"Or were they created by nothing, or were they the creators [of themselves]?

Or did they create the heavens and the earth? Rather, they are not certain." (Qur'an 52: 35-36)

If life is this difficult for the supposed intelligent man with all the advancement in science and technology, to be certain of how it came to be on this earth, is it then the origin of the universe that is certainly proven?!
IslamRe: Atheism Is Foolishness? by sino(m): 4:26pm On Feb 12, 2019
Akin1212:
Lol, I can relate to how you feel right now. In the first tripe you made, you said DNA replication is very accurate. When I objected you came back and started rewriting your mistake by saying the errors due to replication are repaired. Aren't you silly by going back on your words? If replication is accurate, would it be repaired? cheesy. Your headline point was wrong, had you read through the explanation, you wouldn't have said that nonsense. Replication is distinct from repair. Repairs save replication from errors. Hence replication is error prone, even if it is one out of 100000000. Error is error. Bobrisky is ugly, but with make up he is beautiful. Does that change the fact that bobrisky is ugly? NO! Replication is error prone, but with repair replication is made to be nearly accurate. Does that change the fact that replication is error prone? NO

These things are simple, but you're unintelligent enough to grasp them. I have really tried for you. The bolded actually reveals how dishonest you are, even if the repair is after replication, lol. Shame unto you Sino. grin. Empty head!
I said you were discombobulated, but you are actually delusional! Go back and read my post properly, read my initial post on DNA replication and then my referenced quote. It wasn't "my" headline, but a subheading in a textbook of biochemistry! It is funny how you a nobody with absolutely no research worth mentioning to criticize a textbook written by Professors of Biochemistry, please what type of weed are you on?! Perhaps when you write your own textbook like never on Biochemistry, you might have a point here!


Akin1212:
Lol, I have successfully taught you lots of biochemistry with this back and forth, even though you don't want to accept that, it's alright. I am not arguing anymore about Craig Venter research, even lehninger claimed the research was a breakthrough to creating life from inanimate chemicals. So why would I even take a pseudoscientist serious. I have studied biochemistry and graduated and still studying it. If a random scientific rogue like you think I don't know it on Nairaland, what does it change? I have always screenshotted clearly stated explanation to buttress my points. I see how you accepted being schooled on the organization of life, yet I know nothing. I agree, I know nothing but when it comes to you and biochemistry, I am many steps agead of the likes of you. cheesy.

Theres is nothing like intelligent design in science, it has already being established. Embrace science and drop your fantasies. And stop asking questions, I have answered like a million already. Answer the ones I asked. Give us a plausible, hypothetical mechanism of how life began aside abiogenesis. Tell us how Allah the intelligence was able to create errors. grin
I thought as much, you are probably a fresh graduate with little or no contribution to research. No wonder the many gaffes, and your difficulty to access journals that aren't free! The taught of you teaching me anything is ridiculous, while I was pointing you to exclusive journals and textbooks, you were busy googling, going to wiki and quoting news blogs and science mags...

Akin1212:
Lol, again and again. Misrepresentation as usual. Do you want to start misrepresenting English words again?
Accurate, precise, perfect all mean the same thing. Is DNA replication precise? Or the ADDITIONAL repair mecahnism helps set it straight as I am doing to you now. You must learn biochemistry.

Meanwhile, stop avoiding the questions put to you, explain how an intelligence that is all knowing could be so fallible by creating a system of replication that fails sometimes. Give us a plausible, hypothetical meachanism of how this intelligence created life.

Nb: lehninger and all biochemistry texts agree with abiogenesis, so you should be careful what you reference. The quran is not allowed because it is full of fantasies. grin
Gosh! I even made it easy by giving you a hint...Is the DNA replication not precise (accurate) in the base pairing of the nucleotides so that A bonds to T and G to C?! Isn't that the reason for the complementarity of the DNA molecule and the replication is said to be semi-conservative?! I knew you would make another gaffe, I am not surprised at all! You do not have the capacity to argue this, the facts are clear, and not only Lehninger uses the word 'accurate', but also other biochemistry textbooks! But here you are, arguing blindly, like you always do!

Lastly,

"B. Chemical Evolution

In the remainder of this section, we describe the most widely favored scenario for the origin of life.Keep in mind, however, that there are valid scientific objections to this scenario as well as to the several others that have been seriously entertained, so that we are far from certain as to how life arose." (Biochemistry, Voet & Voet)

Real science deals with real data and empirical evidences, but a blind faith in science needs just an assumption from a scientist, and it becomes true! Talk of believing in fantasies.....
IslamRe: Atheism Is Foolishness? by sino(m): 10:15am On Feb 12, 2019
tintingz:
^^^ @sino

You still don't get the absurdity in your argument, even if we agree there's an intelligence behind the repair of DNA does this depict an all-knowing-intelligence?

The Big Bang, abiogenisis, evolution does not negate an intelligent design or God or whatever character you want to call it(since they are fantasies), but it sure make that God imperfect which contradict the attributes of your God, if you agree your God is imperfect then I'm ok with it then we can move on to the next argument.
The first thing you need to understand is that God is the only perfect being, this perfection is also exhibited in all His names and attributes! He is the Creator, and what He (SWT) creates, He creates in a perfect way that suits His perfect wisdom for the perfect purpose He created it for. The cell which is defined as the structural and functional unit of living organism, is perfect for its purpose! Scientist have studied this basic unit of life for several decades, and there is nothing that can be compared to it with regards its structure and function! Since man is claiming to be intelligent, why are they finding it difficult to make such a living system without recourse to it?! If it were something that just randomly came together, then the intelligent scientists would have been able to easily replicate this randomness (since there was no intelligence involved) and provide empirical evidence for this, but what we have after years and millions of dollars in research, they haven't achieved this.
IslamRe: Atheism Is Foolishness? by sino(m):
Akin1212:
Lol, your futile efforts to make it look like I am bragging of biochemistry must be frustrating to you. I am a proud biochemist, you have repeated that in every response. If it pains you so much, isn't it better to just jump in a river than to keep singing it? cheesy Perhaps the fact that I understand the essentials of biochemistry more than an ordinary biologist like you is what hurts your butt grin.

I REPEAT, REPLICATION IS ERROR PRONE. Lehninger attempted to explain DNA replication as error-prone and establish DNA repair as a mechanism that corrects the failures of replication. But how would you even know that? Since you're a biologist and a pseudoscientist who has sworn to misrepresent science in all capacity you can to promote your Allah fantasy. After raising a somewhat silly alarm that I only read a blog, raising a silly excuse that I only read headlines, now you are here showing headlines from Lehninger, lmao. A typical instance of shooting yourself in the skull. grin

Do you need me to explain everything in biochemistry for you? Well, have I not always done that? Now pay attention and see the explanation below.



firstly, if you had read through my responses as you have claimed, you would have seen where I made the above statement. DNA replication occurs with errors more often than not, but the mechanism of DNA repair makes it look as if it is accurate, but replication without repair is INACCURATE. It is the reinforcement of the repair mechanism that buttresses replication. After replication, the enzymatic mechanism of repair checks for error in a process known as "proofreading." Replication itself is just the duplication of a DNA strand by DNA polymerase.

Since I have to tell you everything, there you go! I asked you not to mix it up, but you ended doing that... Facepalmundecided

I don't want to believe you actually think that DNA repair is part of DNA replication, or is that what you actually believe? huh huh huh

This was even explained in your screenshot, but because you cannot comprehend biochemistry, how would you even have the patience to see it. You are always quick to explode your ignorance on our face here on Nairaland, Mr intelligent cheesy

The following is s statement from Lehninger that you screenshotted - "These mistakes sometimes occur because a base is briefly in an unusual tautomeric form (see Fig. 8–9), allowing it to hydrogen- bond with an incorrect partner. In vivo, the error rate is reduced by additional enzymatic mechanisms." You didn't read through the page, did you? Or your blindness to facts didn't let you see that. Perhaps, Allah blocked your sight and let you miss that? Sino, would a distinctive accurate replication need an additional enzymatic mechanism for repair? smiley

Here is another one - "The fidelity of DNA replication is maintained by (1) base selection by the polymerase, (2) a 39S59 proofreading exonuclease activity that is part of most DNA polymerases, and (3) specific repair systems for mismatches left behind after replication." It is stated clearly that the mismatches left behind are repaired by specific repair systems after replication. Any system of a process that is VERY ACCURATE such as DNA replication according to you would not need specific repair systems. Hence, the repair systems and the replication done by DNA Polymerase is what Lehninger referred to as ' Replication is very accurate.' Next time, read to understand. smiley





Lmao, don't quickly add anything Oga, your error is highlighted boldly up there for you, save your errors for yourself. You actually don't have the rights to ask if anyone hasn't learned anything, this exercise has been to school you in basic biochemistry, the one you lack. And this is not bragging, it is the truth.

Errors in replication are repaired during replication or after replication? You need to understand the things you are posting here because a lot of people are reading and you don't want to mislead people, the main reason I have been setting you straight. You have posted tons of nonsense here in the name of biochemistry that ordinary screenshots have spurned. I have uploaded a couple to help you further help you understand biochemistry...

The lehninger textbook you quoted admitted that this fidelity of replication is only nearly perfect. Don't tell me you understand nearly perfect as accurate because accurate means perfect. Lehninger explained the accuracy headline, by introducing repair mechanisms to the replicated DNA molecule. If replication is accurate then what's the need for repair? It is very obvious that you do not think at all, I wonder where you get the confidence to publicly misrepresent science from? Are you not ashamed that very obvious things like these are escaping your comprehension? Does your brain not tell you that whatever is accurate cannot be repaired while you type these jargons?

I am not surprised, you don't even know the levels of organization of life, you don't even know that life precedes cells. I believe I am coming to the end of schooling you. You are the one who should be learning here because you are full of ignorance. Even a primary school student knows that an accurate process does not need a repair mechanism. Don't be shocked that I provided screenshots from your most beloved biochemistry textbook, you don't even know that this textbook does not point to Allah creating anything? You don't even know that Lehninger is a proponent of abiogenesis and evolution? Every fact and truth in all biochemistry textbooks or journals you can reference does not point to Allah, they will always buttress my point. I believe at this stage you should start getting ready to take U-TURN and be referencing the Quran. cheesy

Your effort to avoid providing alternative theories as to how life began on earth is really amusing but expected. You got nothing to say grin

I guess I should keep laughing though at the claptrap you just delivered again, seriously Sino, do you think at all? You mean an accurate replication can be repaired? cheesy

Why don't you give a plausible explanation of how an intelligence is behind the errors of DNA replication and also planned the repair? Does it even make sense to you that an intelligence that is infallible created DNA replication to fail sometimes and also planned how it will be repaired? Does it? cheesy
It seems until you write a whole lot, you wouldn't convince yourself that you have made a point?! All the story story you have written doesn't show that my statement was wrong in anyway. The example of E-coli with about 4.6 X 106 bp was given in Leghninger, and that error occurs only ONCE per 1000 - 10,000 replications! if this is your own definition of prone to error, then you need to examine your brain! Again, Leghninger used VERY ACCURATE to describe the replication process, but olodo like you is arguing this, and explaining erroneously what had already been clarified in the textbook! For your information, the repair process also gives the replication of the DNA that level of accurateness in order to maintain genetic integrity! Again, I stated clearly that such errors are repaired through a process of checks and repairs that follow a guided rule. Even if the repair process is after replication, it is still part of the process of maintaining genomic integrity!. This is breaking it down for all to understand and not going about writing epistles that is just exposing your inadequacies and insecurities! You really need comprehension lessons!

You know next to nothing about abiogenesis, even your understanding of biochemistry is suspect, no wonder you are just dogmatic about your belief in science. Since you believe that life doesn't need intelligence and that abiogenesis is true, answer these questions:

Did Venter and his team depended on life to make their synthetic genome?! And can the synthetic genome function without a living cell?! Would you say Venter and his team were not intelligent?! And given their intelligence and advanced tools, still, they had difficulties in making a synthetic genome on their own, how then was it possible for life to have begun on primitive earth without all these intelligence and sophisticated machineries at the disposal of Venter and his team?!

Remember, the thread is about exposing your foolishness, and by the way, you are doing a great job! wink

I just saw that you presented a dictionary meaning for accurate, funny you jumped the first meaning which is precise, to state that it means perfect, lol, not that perfect is wrong, but if you had any understanding of biochemistry and then Use of English, you would have known that precise is the best synonym to give to accurate in this context. DNA follows a precise (acccurate) base pairing of A-T and G-C during replication...As established, you are a lousy biochemist!
IslamRe: Atheism Is Foolishness? by sino(m): 9:41pm On Feb 11, 2019
Akin1212:
Lol, please and please, let us stay on science alone. I am tired of correcting your pseudoscience. For the records, REPLICATION IS NOT ACCURATE. And this inaccuracy shows that this is not a work of intelligence. I don't know where you saw that replication is accurate, but I am not surprised since you are a renowned pseudoscientist. Why would an error occur at all even once in E. coli if it was programmed by this intelligence you have so much hung up to? Can we say this intelligence is fallible? Or is there any purpose this intelligence programmed these errors for?
If humans have creations that are purely chaotic, and this your God also have creations that are also chaotic, are we now placing humans and this your God on par on their creations and intelligence? I have finally lured you out Sino, lol cheesy cheesy cheesy

Perhaps, randomness and chance are just purely responsible for the order and the chaos?

You really need to start thinking because you are already sinking.
I have read through your responses, and as usual more gaffes and lack of substance. You are a lousy biochemist, and you apparently don’t even know the biochemistry you are bragging about! See the attached snapshot of where it is stated that replication is very accurate. It seems you have not learnt anything in this past few days, rather than looking for what is not lost up and down on wiki, you need to have a deep reflection on your understanding of biochemistry. I present evidences that keep exposing your ignorance in what you claim to be an authority. In all sense of modesty, if I give you a little idea of what research work I had done, I tell you, you would know that all this your bragging on a faceless forum is quite childish and irresponsible!

Let me quickly add that errors in DNA replication are repaired, and not that the errors are left as such. This defeats the assumption again that there is no inherent intelligence, and some of the reasons for these errors are also identified, hence the reason for a repair process…

“Any DNA damage must be repaired if the genetic message is to maintain its integrity. Such repair is possible because of duplex DNA’s inherent information redundancy. The biological importance of DNA repair is indicated by the identification of at least 130 genes in the human genome that participate in DNA repair and by the great variety of DNA repair pathways possessed by even relatively simple organisms such as E. coli. In fact, the major DNA repair processes in eukaryotic cells and E. coli are chemically quite similar.

One of such repair process amongst others is stated below:

"grin. The SOS Response

Agents that damage DNA, such as UV radiation, alkylating agents, and cross-linking agents, induce a complex system of cellular changes in E. coli known as the SOS response. E. coli so treated cease dividing and increase their capacity to repair damaged DNA.” (Source: Biochemistry, Voet & Voet)

nb: Since you claim to be a biochemist, I felt it is not important to fully reference a textbook, I expect you to know where to find these quotes, but if you have difficulties like not having these textbooks, just say, I’ll gladly provide you snapshots, as well as those of the journals you don't have access to online.

If after all your bragging you do not know that DNA replication is this accurate, then what is the essence of your bragging?! Again, you have proven that you are just an empty “korodom”!

IslamRe: Atheism Is Foolishness? by sino(m): 12:26pm On Feb 09, 2019
Akin1212:
I have actually explained life up there. Go back there to read it and think after reading it.

The synthetic genome has all the information to start life or continue it. The bacteria cell is not alive if it's not carrying out homeostasis or metabolic reactions. And yeah inasmuch as the natural genome was excavated, the bacteria will die and the synthetic genome will restart or restore the life process and further continue it. The natural and synthetic genome carry out the same functions, if the natural genome can start the biological functions, so will the synthetic genome. Is that not the common sense you talked about earlier? cheesy

Lol, incoherent analogy again. Let me destroy it one more time. Can the computer function without the old OS? If the old OS contains the information that gives the computer life, and you put a new OS, you have given the computer new life by installing the new OS. Please learn to think properly before giving analogy.

The argument is the origin of life, processes that the information are encoded in the genome. The argument is not the origin of cell or origin of anything that contains life. Don't make the argument what it is not. Stay on point. Abiogenesis does not care about the cell or the bacteria compartments. Abiogenesis only cares about the biological functions that characterizes life. What is life, don't bring arguments about the bacteria cell being dead or not, does the synthetic genome made by humans give life or not? If you like call it continuation of life, in my dictionary something that continues life still gives life.

Now, that we have written epistles on the theory of abiogenesis, and evidence, journals and definitions have flown from left to right. Can you give us evidence on your part of how life started since you are rejecting the honest theories of science?
How can anyone who claims to know anything about biological science say abiogenesis has nothing to do with the origin of the cell?! I am honestly ashamed of you claiming to be a biochemist. A cell is defined as the basic unit of life, and as I have stated previously, without a cell, there is possibly nothing a DNA can do! If there is no computer, your OS is completely useless! The big question is how did the supposed DNA formed in the primitive earth, and was able to function without a cell?! The research in question have shown the difficulty in making a synthetic genome which still needed enzymes and a living organism! With this balderdash you have written up here, it is very evident that you knowledge about abiogenesis is just pedestrian!

Akin1212:
Trash. What an irony about the understanding of the journal. Am I supposed to take someone who asked a silly question whether the genome functioned as a cell serious? You don't even know why the genome was inserted in the yeast cell and you're here talking about understanding the journal. Mtchew, lol Mr intelligent.

It was very important I mentioned that I am a biochemist when we started talking about abiogenesis, unlike you who is nobody, and keep misrepresenting a journal you purposely refused to post its source because of your sheer and obvious intellectual dishonesty. It was not a bragging, I only claimed the needed authority on the topic of discuss which is the origin of life, because biochemistry is the study of life at the molecular level. I know it has been giving you sleepless nights since a month ago that I announced what I studied in school,please I beg you sir Sino, deal with it. cheesy
So with all your bragging biochemist authority, you don’t know how to get a journal fully referenced online except I post a link for you?! Would you also want me to give you access to journals you need to pay for?! Pathetic!

I am a nobody, I agree, but just show me where I misrepresented this research in question. If you do not know the importance of the question with regards to abiogenesis, then you have no business bragging about knowing anything! If you don’t know the importance of the cell as related to the genome to function, then what do you know?! undecided

Akin1212:
Like I said, you know zilch about this topic, I am not even supposed to be going back and forth with a novice like you. Tintingz actually said yoh studied science, maybe biology, but biochemistry is totally alien to you. You are empty when it comea to this field. It has been established that the total genome of all living things contains functional DNA(genes), and junk DNA that basically do nothing. In light of this, if the synthetic genome is a minimized genome compared to the natural, it only means that all or part of the junk DNA was not included. This does not mean that the synthetic genome will still not power the functions of life in the DNA.

But I still have to explain that to Mr intelligent who has in his mind claimed to be intelligent that the likes of us explaining simple processes to him. cheesy
First of all don’t bother your mind about what I studied, but I am surely finding your claim to have studied biochemistry and now claiming authority as very ridiculous with your often repeated gaffes. You should note that even in this minimal synthetic genome, about 17% of it cannot be explained as regards the function, which is about 79 genes out of the 473 genes and these genes were important for the proper functioning of the cell. Mr. biochemist, the excerpt I quoted was to show you what the research is all about, and not your theory of abiogenesis! You need not explain anything to me, the text was very clear even to someone with minimal scientific knowledge!

Akin1212:
Lol, I am not defining abiogenesis again for the umpteenth time
By now, if you have read the first two response to your trash, you must have gotten the picture. And if you don't, I wish you luck in your ignorance.

Anybody, of course religious bigots like you can claim that the synthetic bacteria is not giving life to the bacteria cell to shield your interests of Allah or God. It is allowed. But the fact is that, the bacteria is surviving on the synthetic genome made from ordinary chemicals. If this does not support the theory that life arose from chemicals, I don't know what else it supports. Lol.


Meanwhile, I am waiting for you to give me plausible hypothetical mechanisms on how God or Allah created life as I have given you on abiogenesis.

And remember, in case you argue this matter with someone else. Abiogenesis is not concerned about how cell came about, or how humans came about. It is how life came about. But then, you have to understand what life is in the first place. And don't also forget that the genome also contains the information of making a cell wink
And I will keep telling you henceforth that you know next to nothing about abiogenesis and your knowledge about biochemistry cum molecular biology is very poor! This is not about defending my interest that Allah (SWT) is the creator, but rather the nitty-gritty of a research and your claim that it supports abiogenesis. How can you talk about origin of life and say that the cell isn’t part of it?! You have just shot yourself in the foot by stating the obvious, if the information for making life is in the genome, and you want us to believe that the genome is life giving, how did the first genome give birth to life?! Now I am not even asking too much as to how the genome was formed from the primitive earth constituents, without the enzymes and preexisting life in the first instance, but how did the first genome made its own cell?! Obviously, without the cell, the genome cannot function! And part of the question you should provide answers for is how did this genome randomly “knew” what it needed by making a cell and all its components with unique and specific functions to continue replicating?!

Nb: Venters synthetic genome, will remain a lifeless repository of information without a functional cell, and even if in the future they are able to synthesize a cell from chemicals by a more advance knowledge and tools, it only give credence to the fact that life on earth was never by accident, but definitely brought about by intelligence!
IslamRe: Atheism Is Foolishness? by sino(m): 12:09pm On Feb 09, 2019
Akin1212:
Thank you for this. I suppose you omitted the source to cover your dishonesty once again. But to show you that before you even thought of misrepresenting the research once again,I have read the journal over and ober again. I will include my source and I will also highlight where you misrepresented in the journal. Aside from the fact thay you didn't specify your source which automatically disqualifes your jargon.

1. "They used whole genome design and chemical synthesis" specifies that chemical raw materials were used to make artificial or synthetic DNA which could carry out the same functions of a natural DNA inside a cell from scratch. What part of this is actually difficult for you to grab? This alone, proves that life can arise from chemicals or organic compounds which excellently explains abiogenesis.

2. Lol, you actually used your hand to bring a source, but the content of the source does not suit your narrative but you had to narrate it in a way that fits the Allah agenda. Let me explain the whole concept of life, genome and cells for you. Maybe, just maybe you'll wake up from your ignorance.

You see, living things are their genomes. The genome is the complete genetic information of an organism or a cell. The genome consists of coding genes(exons), non coding DNA(introns), the DNA inside the mitchondria and also inside the chloroplasts.

Now, life on earth is defined scientifically as a series of processes or metabolic reactions that give rise basically to the following biological functions. Movement or locomotion, Respiration, Nutrition, Irritability, Growth, Excretion, reproduction and death. This is basic integrated science. Right? And that's just on the basic level, but it also applies on all levels. In another explanation, biochemically precisely, anything that can perform anabolism and catabolism is alive.

Now, cells carry out the biological functions and they also carry out anabolism and catabolism, a cell is nothing but a compartment where these reactions take place.

The genome is the information bank for these biological functions and reactions. The genome is where the information of how these processes should be done is stored

So, if genomics is now moving from a descriptive phase to a synthetic phase where whole genomes can be built by chemical synthesis, it means we can build a whole genome from starting chemicals such as Carbon, Nitrogen, hydrogen and oxygen. This consequently means that we can build from ordinary chemicals the information required to sustain life or start life. This means that we can create life in its simplest form. Is it not easy to grasp?

Even if we learnt from the natural sequence and created our own sequence, does that mean we didn't create a synthetic life? Religious bigots have always asked scientists to create a life to convince them, now that it is done, they are coming up with excuses that it was copied from the natural one. Meanwhile, before, their bragging was that we can create things, but we can't give them life. This is becoming ridiculous lol.

The most important thing here is that, these scientists created a synthetic DNA, excavated the natural DNA without which the bacteria would be dead and incorporated the synthetic DNA which works just like the natural DNA. Is that the creation of life?

Their excuse now will be, why didn't you create a cell? cheesy

3. Your third flaw was also highlighted, its a shame you don't understand science, nor the research you're misrepresenting but you claim you do. Lol

A person who understands this research will not even ask if the genome started functioning as a cell. What kind of ignorance is this? In your quest to appear intelligent, you keep showing how unintelligent you are. This is another intellectual suicide. Can the DNA function as a cell? A cell without a DNA is dead. The artificial genome created was incorporated into

The following abstract says it all, the source is included in my own case. cheesy

Abstract
"We report the design, synthesis, and assembly of the 1.08–mega–base pair Mycoplasma mycoides JCVI-syn1.0 genome starting from digitized genome sequence information and its transplantation into a M. capricolum recipient cell to create new M. mycoides cells that are controlled only by the synthetic chromosome. The only DNA in the cells is the designed synthetic DNA sequence, including “watermark” sequences and other designed gene deletions and polymorphisms, and mutations acquired during the building process. The new cells have expected phenotypic properties and are capable of continuous self-replication."

From the research article, if Sino by chance knows anything about molecular biology, he would know why the genome was inserted into yeast cells. But I guess I'll have to help him again, read below from the source.

"We developed a strategy for assembling viral-sized pieces to produce large DNA molecules that enabled us to assemble a synthetic M. genitalium genome in four stages from chemically synthesized DNA cassettes averaging about 6 kb in size. This was accomplished through a combination of in vitro enzymatic methods and in vivo recombination in Saccharomyces cerevisiae. The whole synthetic genome [582,970 base pairs (bp)] was stably grown as a yeast centromeric plasmid (YCp) (7)."


It is obvious that the genome was assembled by enzymatic process and by recombination process in yeast. Sino wouldn't understand that, would he? I will not respond further, here is the link to the source, the link which Sino refused to post because of his dishonesty. Biochemistry is very simple.

http://science.sciencemag.org/content/329/5987/52.full
All this epistle isn’t really necessary, even at that, you cannot prove where I lied as you initially claimed, and your claim of misrepresentation is
very laughable. Seems you are discombobulated, and perhaps need glasses, didn’t you see the source in my post?! FYI, the research article I referenced is a 2016 paper, and you are quoting a 2010, although it is still the same work, but Venter and his team were able to create a minimal cell which was optimally functional called syn3.0 unlike the errors they encountered in the 2010 paper. This is very evident in the abstract I posted…If you do not have the means to get some exclusive scientific journals online, it isn’t my fault na…

Secondly, they didn’t create a cell from scratch and that is one of my point, what was said to have been created from scratch is the genome and that is why the title of the paper stated that “Design and synthesis of a minimal bacterial genome”, although this is after they had studied and copied the naturally occurring one…You know it is like copying an OS, use the information you gathered to create your own, then claiming that you created an OS from scratch, but we both know you copied!

The reason this does not support abiogenesis is the fact that they had to transplant the synthetic genome into a cell! Note, the DNA also contains the information for the synthesis of the ‘cell’, so when you want to claim abiogenesis, then we need to ask, was it the cell that was first to be formed or was it the DNA?! As I have stated earlier, the genome will do nothing if there isn’t a cell that would interpret the information, the DNA does contain the instructions to be used in a living cell, but without a living cell, it is useless! All you need here is to prove me wrong!

There is a need to correct you on the starting materials for this experiment, Venter and his team didn’t use just H, C, O, N, P etc. but rather a chemically activated nucleotide, just like in PCR, even at that, the artificial synthesis of the DNA sequence can only reach about 50bp (with all the intelligence o), hence the need to resort to natural living organism and their enzymes to help them reach the very long sequence found in a genome. All these were diagrammatically represented in my post, but you sha want to prove you understand the work, but ending up saying nothing!

The funny thing is that for a supposed unintelligent process of the origin of life, these intelligent scientist have been finding it extremely difficult to replicate, even with all the advancement, and the supposed synthetic genome, they still need the cell, the unintelligent created cell! So what does this tell you?! With all your intelligence, you can only copy, and the synthetic genome give credence to the fact that intelligence is really necessary for life, and not some form of chance or randomness!
IslamRe: Atheism Is Foolishness? by sino(m): 12:08pm On Feb 09, 2019
Akin1212:
As much as this is laughable, once again you have succeeded in shooting yourself in the foot. And this time, you did exceptionally. Your desperation to establish that I have faith in science which is nothing but a laughable failed clapback has been noticed. But guess what, you're just making noise. grin

Anyone with knowledge in science will not find it difficult at all to see your obvious flaws littered in the jargon it took you two days to put together up there. But in the jargon, I will make bold your errors for you to see. It's left to you to see them.

- Just do yourself a favor and stop talking about science, amino acid don't give rise to life. Perhaps, you don't even know what life is, perhaps you think there's a particular thing called life in living things. I give up on your ignorance Sino.

- Amino acids are either D- amino or L-amino. But the ones found essential to life are L-amino, which were produced in the Urey-Miller experiment. This is however a plausible evidence that life through abiogenesis. But instead you believe that God breathe amino acids into humans, but can't prove it. Did God also breathe life into plants and other animals too? Explain to us or read to us from your trash book extensively how God gave life to living things, please.
"In Fig. 2 is shown a paper chromatogram run in n-butanol-acetic acid-water mixture followed by water saturated phenol, and spraying with ninhydrin. Identification of an amino acid was made when the Rf value (the ratio of the distance traveled by the amino acid to the distance traveled by the solvent front), the shape, and the color of the spot were the same on a known, unknown, and mixture of the known and unknown; and when consistent results were obtained with chromatogram using phenol and 77% ethanol. On this basis glycine, α-alanine and β-alanine are identified. The identification of the aspartic acid and a-amino-n-butyric acid is less certain because the spots are quite weak."

Source:Miller, S. L. (1953). A Production of Amino Acids Under Possible Primitive Earth Conditions. Science, 117(3046), 528–529.doi:10.1126/science.117.3046.528

The abstract of a recent research using advanced research tools to analyse the products from the Miller experiment, had the following information:

"some of Miller's remaining original samples were analyzed with modern equipment (Johnson et al. Science 322:404-404, 2008; Parker et al. Proc Natl Acad Sci 108:5526-5531, 2011) and a total of 23 racemic amino acids were identified"

https://www.ncbi.nlm.nih.gov/pubmed/26508401

It should be noted that the product of this experiment being racemic is the least of the problems of this research, even from the construct of the title, Miller acknowledges the fact that the conditions of the primitive atmosphere was indeed speculative, and further research has shown this to be true!

Mr. Scientist Biochemist authority, the fact that the experiment produced both D and L form in a 50/50 ratio, portends trouble for abiogenesis since you yourself have acknowledged the L-form being the one essential to life! If your lecturers knew their onions, they would have mentioned the thalidomide disaster of 1962 while teaching you chirality of macromolecules, structures and functions!

Akin1212:
Lol, a scientist like you, or better a science critic like you who finds it difficult to criticize your faith is so obsessed with the word DESIGN because it so much fits and favors your narrative of a designer or a creator which you always hurriedly call your God or Allah. You see, it's not about a designer or anyone, just drop it and stop validating nonsense. They could use the word design in journals and they could also use code, they could as well use program, and the same way I can as well use DNAer or a builder. The only difference here is your particular choice and insistence in using the word designer which long last doesn't still prove anything. Please apply intellect, don't be a subject to your fantasies. Let's know what we're doing.
It doesn’t prove anything you say?! But the researcher who is an intelligent being, applying his intellect, synthesize a genome, he claims to have created a synthetic life, and you are here bragging about such achievement and intelligence that wasn’t as a result of any form of randomness, but a well detailed process of planning and execution. But the original life, which the researcher studied extensively to learn and copy from came from no intelligence?! And I am the one with fantasies?!

Akin1212:
You are getting a wrong notion and use of the word random or its use, arent you? Perhaps you don't deeply understand Science to that point. Do you know that something can randomly be organized? Do you know that certain atoms will only bond to specific atoms at certain conditions and will continue to bond if the condition persists? The bonding in the DNA can be organized by chance depending on the conditions present prior to the bonding which is important for the structure of these molecules. And this bonding is also controlled by enzymes providing reactive active sites for them to happen. There's no inherent intelligence behind it, you have just made another bold claim. You have just once again filled the gap of knowledge by attributing the observation to an intelligence that cannot be proven. Why, ehn why? If these enzymes are removed, if these conditions are changed, the bonding will not take place at all, no matter what the intelligence you claimed has done. And these conditions are what we have termed the natural laws in science. So has your intelligent creator not failed if humans can alter his intelligence?
I expected you to have claimed that the researchers who claim to have created a synthetic life would have done so out of shear randomness and chance too as abiogenesis suggests, but what we have is the contrary! The problem with your line of thought is that the DNA is not just a randomly organized molecule, it is specific and contains information that can be replicated and expressed to form meaningful macromolecules such as the enzymes you mentioned! If there is no inherent intelligence in these structures, how come there is a need for special enzymes to direct the proper bonding, winding and unwinding for specific functions?! How come there is a process of replication with checks for errors so as to maintain genetic integrity?! How come there is a genetic code that is translated into functional proteins for specific processes and pathways in the cell?! All these were just randomness and chance abi?! But for an intelligent scientist to do anything, he goes back to the unintelligent ‘designs’ all the time! Should you or anyone claim any form of intelligence superior to this unintelligent randomness?! You say I know now book, but you they copy me and you they pass, shey you sure say you get sense so?!

Akin1212:
Lol, so common sense is that if they designed a genome by looking at the natural one, then the natural one too was designed? Lwkmd, you will never cease to amuse me. Okay then, let's apply your common sense. If the artificial genome which is observable was designed by observable beings, common sense should also tell us that the natural genome which is also observable too should be designed by an observable being. Now, where is the designer who designed the natural genome? Don't give excuses here Sino, just provide the designer instanta. grin. Let's see how common sense is so common to you, Mr intelligent.

Let me guess, you cannot! You must be a joke bro..... grin

Your question about alphabets is a result of your childish reasoning. You must have skipped logic classes in maths in secondary school, or perhaps you didn't do permutation and factorial in mathematics. However, I will try to help you think better bro, after all you have claimed that you are more intelligent than us.

Given billions of years, I don't know for sure if a novel can be written from 26 letters, but if the conditions that can incluence iit are available, it will be written fine fine, despite the fact that the analogy is stupid as usual. Billions of years is not 100 thousand years. Open your mind and learn. And this looks plausible than the useless claim or excuse that Allah did it, Allah did nothing!

The 4 letters in DNA code is just informative letters that tell us how nucleotide bases are arranged in the genome, and different arrangements of the codes has lead to 8.7 million trials and errors. By saying it gave rise to a working order is another nonsense from you. It has created order and also chaos. We have seen people who were born malformed because of the chaos this randomness can cause. Or do you think humans or other animals are perfect? You are really a joke bro. You know nothing!
Childish reasoning?! What are the right conditions that are going to influence writing a novel by randomly writing 26 letters without intelligence?! Mr. science with an adult reasoning…I have said it before, billions of years is not an intelligent answer, because without intelligence, you possibly cannot achieve anything, our reality has proven this again and again, and the research in question also give credence to this! If my analogy is stupid, perhaps I should use that of Venter, I’m sure he isn’t stupid to have used an OS and a computer. Now tell me the possibility of creating a new OS using any programming language say Python, by randomly writing the codes for billions of years. Let me help you a little, one of the condition is getting the syntax right and debugging. So if per chance you found an OS, you spent all of your intelligence and other material resources to decode it, and then use that knowledge to write yours, would you sound intelligent to claim that the OS you found was as a result of an unintelligent randomness?!

You see when I stated that you are a lousy biochemist, it would seem like an insult, the DNA letters represents the bases in the DNA sequence, it holds information that can be interpreted, the reason for the analogy with the 26 letters. The information the DNA carries are replicated in a process that is almost error free due to inbuilt checks and repairs by specialized enzymes, there are rules that guide this process (it actually looks like it is programmed to do so and not deviate from such programe). A 200 level biochemistry student would tell you this, but because you want to argue, you suspended your brain to attack this basic and very important aspect of the DNA! It is not 8.7 million trials and errors, but rather millions of diverse unique living entities with functioning DNA, that specifically replicate with limited errors, to continue propagating these living entities!

"Replication Is Very Accurate

Replication proceeds with an extraordinary degree of fidelity. In E. coli, a mistake is made only once for every 109 to 1010 nucleotides added. For the E. coli chromosome of ~4.6 X106 bp, this means that an error occurs only once per 1,000 to 10,000 replications." (Lehniger, Principle of Biochemistry) I hope you wouldn’t request for the link to this…

Again, there are some of human creation or let’s call it inventions that are purely chaotic, does that mean there was no intelligence behind it?! Are you sure you are thinking right like this?!
IslamRe: Atheism Is Foolishness? by sino(m): 3:21pm On Feb 07, 2019
Akin1212:
Oh, there he goes again. The story of how his level of intelligence is greater than ours, and he cannot easily tell a lie when he sees one. How a book sent by invisible angels by invisible Allah beats years of work carried out in the lab is a nice place to hide for an intelligent person like Sino. grin

From the source again : "Professor Julian Savulescu, an expert in Practical Ethics at the University of Oxford, said: “Venter is creaking open the most profound door in humanity’s history, potentially peeking into its destiny.

"He is going toward the role of a god: creating artificial life that could never have existed naturally."


This is the first synthetic cell that's been made, and we call it synthetic because the cell is totally derived from a synthetic chromosome, made with four bottles of chemicals on a chemical synthesizer, starting with information in a computer(lettered codes)," said Dr Venter.

It is evident that scientists have made it known and even demonstrated that life can be created from chemicals, non living materials. But our intelligent Sino who is also a bogus liar said they haven't. Who would take such a person serious?

Sino, you're very correct that we say science is true whether you believe it or not, you are an evidence of that. If not for science, we won't even be doing this on the internet, would we?
If not for science you will not be struggling to discredit the work of Craig Venter and be misrepresenting it here on Nairaland with sheer dishonesty. You must have faith and fantasy to have such dishonesty. Lol.

However, the only counter explanation you have is that Allah did it, because it was written by an illiterate 1400 years ago. Is that even sensible? Why not just scrutinize this Allah did it excuse as much as you're scrutinizing abiogenesis? Why not provide testable evidence or plausible explanations of how this Allah did it?

On the basis of abiogenesis, there's more plausibility and objectivity than your excuse of Allah. You just want us to accept that Allah did it and not ask questions? But you're quick to throw 100s of questions my way, but I still answered them. You on the other hand would only quote a verse from your trash book either telling us that our knowledge is too small to know or that we shouldn't question Allah. Perhaps your brain is too low to carry the explanations given on abiogenesis too. Lol

But what do we even know sef, sheybi you're the most intelligent. grin

Attached below is a sample genetic code usually stored in the computer.
I would repeat it again; my level of intelligence is way beyond your likes that are very lazy to do any form of research (including reading and understanding a published journal) but come on a faceless forum to brag about being a scientist or a biochemist! I would help you post the primary objective of the research by Venter, to show your ignorance the more:

"Here we report a new cell, JCVI-syn3.0 (abbreviated syn3.0), that is controlled by a 531–kilobase pair (kbp) synthetic genome that encodes 438 proteins and 35 annotated RNAs. It is a working approximation to a minimal cell. Its genome is substantially smaller than that of M. genitalium, and its doubling rate is about five times as fast." (Ibid.)

Craig didn’t claim to have proved abiogenesis, and moreover, he and his team still needed life, that of yeast and a bacterial cell for their synthetic genome to function.

This brings back to the quote from a leading geneticist again:

“To my mind Craig has somewhat overplayed the importance of this,” said David Baltimore, a leading geneticist at Caltech. Dr. Baltimore described the result as “a technical tour de force” but not breakthrough science, but just a matter of scale…. [b]“He has not created life, only mimicked it,” [/b]Dr. Baltimore said."

Instead of all the unnecessary theatrics, long stories and attaching picture of a genetic code (does calling it a code also baloney since a code would definitely require a programmer?!), just show me my bogus lie and how I misrepresented him, don’t come quoting a Professor of practical ethics to me or making spurious claims, rather show how this research by Craig created life from just chemicals to prove abiogenesis!
IslamRe: Atheism Is Foolishness? by sino(m): 3:21pm On Feb 07, 2019
Akin1212:
You critic the evidence or you critic me? Lol, we will have a breakthrough when you stop attacking me and instead focus on the matter. You cannot drive home your points by attacking me or attacking what I studied in school. It is unbecoming to the hopes of you unlearning, learning and relearning. And you really need to.

If you critic provided evidence, then why can't we critic your belief. Evidence is more reliable than mere faith which is totally based on 'the prophet says Allah said,' just hearsays.

Theories are meant to be falsified based on further research and experiments, not by a random Sino on Nairaland.

It surprises me that you of all people is saying there is no absolute truth when it comes to scientific theories, but the same you actually believes that Islam that is rejected by over 5 billion people in the world is an absolute truth. cheesy. It says so much about your intellectual truth and humility. Scientific theories with evidence are being rejected by the likes of you who lack understanding of them because you have sworn to adhere to fantasies and fairy tales, just as the one we did before we were allowed to comment in this section.

Scientific theories are open to further research and questioning, and that's the honest thing about science. It has to be true here in Africa and also in Asia. Unlike your religion which is only true in certain places in the world and is very much closed to criticism and questioning. Isn't it?

That I know close to nothing about the scientific research I quote here, you can continue throwing jabs if it makes your day lol, but it doesn't change the fact that Allah does not exist anywhere.

That's why they are called references my friend. The journals are online, detailed processes of how the work was carried out, the apparatus and materials used, how the conclusions were reached etc are available for anyone who wants to reproduce the work. That's clearly the highest form of honesty. And Sino, that obviously is better than saying we cannot see God bla bla bla, better than saying only the prophets can hear from God bla bla bla.
Lol, attacking you by stating what you were bragging about with no one asking you in the first place?! Are you not a biochemist again?! So what is the attack here?!

Well the fact still remains that scientific theories and even facts are falsifiable, and this happens to be an integral part of the scientific method. I do not reject scientific theories or facts, I understand the limits and when there are further researches that questions the veracity of previous theories or there happens to be more questions arriving from a research that aims at proving a theory, I acknowledge them and use such to critic the likes of you who hold on to science as the absolute truth. The Qur’an which I believe to be true hasn’t changed from inception, but I can mention many scientific theories that had to be reviewed or rejected! This supports the obvious truth I had quoted in the Qur’an that science as well as man seeking the origin of the universe as well as life are perpetually uncertain!

I do not like throwing jabs at anyone, but you are quite notorious for your condescending approach as well as making mockery of what I believe, I know it makes you feel intelligent more than a theist, but how come you are feeling insulted when I do the same about your person?! Does being an atheist mean you shouldn’t employ decorum when engaging in discussion especially on a faceless forum?!

My issue is not the fact that these researches aren’t available, but the fact that you are making spurious conclusions which is actually different from what the research is all about. I do not just read one article, especially from a blog to start bragging what the research is all about; I dig deeper, going straight to other reports as well as the research paper itself! Then I make an informed opinion.

Akin1212:
I guess I should stop taking you serious. Who takes someone who does cognitive dissonance serious?
After saying I provided some experiments as facts, after saying I provided the arrangement of synthetic DNA as facts, what other evidence are you asking for? Or what evidence have you provided for your claims?

Saying amino acids are alive is tantamount to committing an intellectual suicide. I don't know how to save you from that than to bury you. RIP.
Of course you couldn’t refute the other points I raised which is actually backed up by further research, but rather hold on to amino-acids being ‘alive’ as an easy way out. Please tell me how the Urey-Miller experiment proves abiogenesis?! How did the supposed racemic amino-acids give rise to life?! No scratch that, what were the amino-acids produced and how did this experiment account for at least 50% of the amino-acids required to synthesize necessary proteins that are essential for life?! Again how did the polymerization of these amino-acids happen?! These are part of the questions my ‘alive’ was referring to, but it doesn’t matter to you, if the experiment as well as further experiments cannot answer these questions and even more, then you are believer, having blind faith in science!

Akin1212:
You just have to always introduce a certain level of ignorance to science whenever you struggle to describe it by introducing your creator theory. This same you believes that the creator designed everything but the creator was designed from nothing or not designed at all. grin. This is the highest level of dissonance I have ever come across. Yet, you have zero evidence of this creator.

Researchers arranged DNA strand with the computer, does that make them designers or researchers? When you don't take your time to think deeply, you will always be a joke. grin

Lol the twist angles or the angles of rotation of the DNA double stranded molecule is not a proof that someone did it, it is a proof that the DNA consists of non living atoms that bond with themselves. When atoms form bond with themselves, as a result of repulsion, angles are formed. And since the atoms are repeated in the DNA molecule, the angles will be uniform. Don't always fill the gap of knowledge with fantasies.

Again, you're shooting yourself in the foot. It took 3 billion years after the formation of the planet earth for man to surface. In 3 billion years which is close to forever, there's every chance that man could come or something else could come, but man came. It was a chance, or do we need to explain chances for you again? Man was not the first form of life, and the randomness obviously produced diversities of life, which is about 8.7 million species. What's so hard in understanding this? Life is the random occurrence and it happened, so deal with it.
The joke is on you Mr. Scientist, the research and researchers you are referring me to use the word design repeatedly through their research article, perhaps they were stupid to have used such a word?! You don’t get it, when you make use of structures to describe something, you are inadvertently acknowledging there is a design, a pattern, be it uniform or not (but this case uniform). These bonds are quite important for the functions of these macromolecules, and in the DNA, it isn’t just random bonding, but information-driven bonding which enables it to function optimally with respect to its replication and transcription. The bonds, the number of base pairs per turn, the form found in physiology are so unique and important that you can’t deny the intelligence! You ought to know about structures and functions na, but alas! Here we are… What the researchers have been able to do is study and learn from a naturally occurring DNA (genome), designed their own with the aid of a computer! If they say they design, who are you to question this?! And of course if they actually had to design one, common sense dictates that the naturally occurring one must have also been designed! Oh i forgot, common sense they say, isn't common!

Life happened no doubt, but my question is given similar billions of years, and with 26 alphabets to be randomly written, what would be the chances of writing a best-selling novel as well as other diverse meaningful story books, letters etc.?! Does it look plausible to you?! From the single unicellular organisms to the complex multicellular organisms, do you see any purposeless living organism?! How did this randomness ‘create’ such a working order using just 4 ‘alphabets’?! That is the big question your randomness and chance are yet to answer!

Akin1212:
Lmao grin. SIno, Sino, you went through all these to present a lie? I'll make it easy for you and anyone reading. I will quote the first paragraph of the source, I will then define abiogenesis, I will then quote some other paragraphs of the source and then I will finally address your baloney once more. Here we go....

First paragraph of the source : "Dr Craig Venter, a multi-millionaire pioneer in genetics, and his team have managed to make a completely new "synthetic" life form from a mix of chemicals."

Definition of Abiogenesis : "Abiogenesis, or informally the origin of life, is the natural process by which life has arisen from non-living matter, such as simple organic compounds."

From the above, we have seen that Craig Venter and his team made a completely new synthetic life form from a mix of chemicals, and we have also seen that abiogenesis is the natural process of making life from simple organic compounds.

But our dear Sino has quoted something else entirely, dishonestly explaining what the article or source does not explain. Why do you lie to yourself Sino?

Further quotes from the source : "They manufactured a new chromosome from artificial DNA in a test tube, then transferred it into an empty cell and watched it multiply – the very definition of being alive." --- From synthetic DNA that was arranged, they made a new chromosome that was able to divide and multiply. This however quenches the arguments that life comes from God, and further validates the scientific position that life is just a series of reactions or processes.

Further quotes from the source : "The man-made single cell "creature", which is a modified version of one of the simplest bacteria on earth, proves that the technology works."----- The cell is completely man made from scratch and it is a prototype of the simplest bacteria on earth, but this one is modified with watermarks to differentiate it from the natural bacteria.

Further quotes from the source : "First they sequenced the genetic code of Mycoplasma genitalium, the world's smallest bacteria that lives in cattle and goats, and stored the information on a computer."--- They looked at the genetic code of the smallest bacteria in the world and sequenced it. Gene sequencing is the process of identifying how the nucleotides are arranged in the DNA of a cell. They copied the code, which are just a series of lettered representation of nucleotides, I will attach a sample picture. As against the baloney our pseudoscientist Sino wrote up there. This is synonymous to looking at the code that was used to produce one OS and use the same code to produce your own OS. Haven't you created a new Computer? Sino is very very dishonest, and at this point, it's becoming a waste of time discussing with someone who is intellectually dishonest.

The genetic code stored in a computer is always like this - ATTCGAGTACTTAAACTATTTGGGCGTACGTAGCTGACAGTACGT

Here is the source again ---- https://www.telegraph.co.uk/news/science/7745868/Scientist-Craig-Venter-creates-life-for-first-time-in-laboratory-sparking-debate-about-playing-god.html
You have just shown that you lack the understanding of the science in the research, but merely do follow-follow. So if I copy windows OS to write a code for my own OS, Did I create a new computer or a new OS?! Don’t you know the difference between Hardware and software ni?! You see, I omitted the reference for my quoted post for a reason, to weigh your understanding of what is being discussed here and not some propaganda believes about abiogenesis…. I will help you with quotes from the original research paper, the abstract and part of their discussion and conclusion, then you must show where I lied! Please take note of the word DESIGN!

DESIGN and synthesis of a minimal bacterial genome

Abstract

We used whole-genome DESIGN and complete chemical synthesis to minimize the 1079–kilobase pair synthetic genome of Mycoplasma mycoides JCVI-syn1.0. An initial DESIGN, based on collective knowledge of molecular biology combined with limited transposon mutagenesis data, failed to produce a viable cell. Improved transposon mutagenesis methods revealed a class of quasi-essential genes that are needed for robust growth, explaining the failure of our initial DESIGN. Three cycles of DESIGN, synthesis, and testing, with retention of quasi-essential genes, produced JCVI-syn3.0 (531 kilobase pairs, 473 genes), which has a genome smaller than that of any autonomously replicating cell found in nature. JCVI-syn3.0 retains almost all genes involved in the synthesis and processing of macromolecules. Unexpectedly, it also contains 149 genes with unknown biological functions. JCVI-syn3.0 is a versatile platform for investigating the core functions of life and for exploring whole-genome DESIGN.

So does this explain abiogenesis?! Let’s go further into the article....

"Genomics is moving from a descriptive phase, in which genomes are sequenced and analyzed, to a synthetic phase, in which whole genomes can be built by chemical synthesis. As the detailed genetic requirements for life are discovered, it will become possible to design whole genomes from first principles, build them by chemical synthesis, and then bring them to life by installation into a receptive cellular environment. We have applied this whole-genome design and synthesis approach to the problem of minimizing a cellular genome."

The bold might be a little bit confusing, but I’ll explain, you see the synthetic genome is what is built from scratch, of course with the help of learning from the original design, and this did not form a life on its own as it would be shown later…

"In contrast, we set out to construct a minimal cellular genome in order to experimentally determine a core set of genes for an independently replicating cell. We designed a genome using genes from M. mycoides JCVI-syn1.0 (10). This mycoplasma cell has several advantages for this purpose. First, the mycoplasmas already have very small genomes. They have evolved from gram-positive bacteria with larger genomes by losing genes that are unnecessary in their niche as mammalian parasites. They are already far along an evolutionary pathway to a minimal genome, and consequently they are likely to have fewer functionally redundant genes than other bacteria. We also have a highly developed set of tools for building this genome and for assembling and manipulating the genome as an extra chromosome in yeast."

The first introduction of this synthetic genome to life can be seen here where it is placed and manipulated in a yeast cell….So what happens after?! Did this genome start functioning as a cell on its own to prove what Mr. Scientist wants us to believe about abiogenesis?!

What actually happened is the transplanting of the manipulated genome into an already existing bacterial cell.

"At each cycle, the genome is built as a centromeric plasmid in yeast, then tested by transplantation of the genome into an M. capricolum recipient." (See attached picture).

Source: Clyde A. Hutchison III et al.Design and synthesis of a minimal bacterial genome Science 351, (2016); DOI: 10.1126/science.aad6253

How does all the above different from what I posted, or how does it show that I lied Mr. Biochemist?!

It is impossible for the synthetic genome to function without the machinery for reading and translating the information embedded in it, further replication after transplantation means that the synthetic genome contain the necessary information to continue living and not starting life from the scratch! The critical question you need to ask yourself is that was the recipient bacteria dead?! FYI, a dead cell cannot and will not translate or read any information transplanted into it! It is just like the OS analogy, if the computer is dead, there is absolutely nothing your new OS will do, except the computer is working, you format the hdd, and then install your own OS! I hope this is clear enough!

IslamRe: Atheism Is Foolishness? by sino(m): 1:09pm On Feb 06, 2019
Akin1212:
I am almost getting tired responding with the same thing to your mediocre mind. Once again there is no faith being exercised where there is objective evidence. Scientific theories don't need to be believed, they need to be understood!
The joke is on you, contrary to what you have written about science not being believed, your post suggest you don't even understand the science! Hence the need for a faith in science! You have repeatedly showed lack of understanding of the science you present!


Akin1212:
Ad hominem. Why attribute it to me? Did I ever say I want you to 'believe' anything? If yes, could you please point to where I said that? I have only told you that Abiogenesis is the scientific theory based on series of experiments that have hard facts. Do you even need to believe anything, or are you cursed to believe everything?

In the course of running abiogenesis down your weak mind, I explained many scientific facts and truths, such as what all living things are made up of etc. It's not my fault that you cannot comprehend, Mr.
Your posts are always riddled with ad hominem, but hey, it doesn't matter, because you are way over your head with your ego...

You presented your supposed hard evidence to support your claim, and I critic them as not being enough to arrive at your conclusion! Theories are meant to be falsifiable, there is no absolute truth when it come to some of these theories and even supposed facts, especially when there is still room for more research! When you reach that level of intellectual humility, you won't come on a faceless forum to be bragging about research you know next to nothing about other than reading excerpts from online news blogs!

Akin1212:
Lol, when you see ignorance, you know it. Are you trying to deceive the lay people by using the word 'alive' as regarding amino acids? I won't even respond to that hysterical baloney. The conditions of the early earth were not assumed. Read more bro
Instead of providing the supposed incontrovertible evidences, Mr. 'Scientist' goes on personal attacks, you keep proving you know next to nothing about these researches...You should rather take your advice and perhaps save yourself from this embarrassment!


Akin1212:
Presuppositions again, a design only needs a designer, perhaps a DNA need a DNAer? cheesy

The first failure of logic here is to call a DNA a design, throw that babble out the window, please. When you're ready to discuss about the things you have zero knowledge about, we'll discuss it.
You obviously think man is the only living thing on earth. Lol, perhaps you're driven by the egoistic, vaguely purposeful life you're living to think of man alone as the center of all living things? Lwkmd. Wake up bro, it's not about typing grammar and epistles.
Mr. biochemist, what did the researchers do with the computer to 'create' the synthetic DNA?! Again, no substance in your response, at this rate I can clearly see that you are actually bereft of any biochemistry knowledge...If not so, you must have been taught a bit about structures of biomolecules, specifically the DNA molecule being a double stranded helix with proportional measurements and angles. If you have any form of advance studies in biochemistry, you would have been introduced to biophysics of the DNA molecule...Wait, aren't you the biochemist here?!

You absolutely have no clue! Just tell me how a base pair took a supposed intelligent human after extensive studies of the DNA, and numerous failures, more than 2 decades, and 3 billion base pairs was just from a random occurrence?! Were there failures too?! and what kept this random process to continue so as to create these COMPLEXITY and DIVERSITY (since you didn't see this before) we now see?! What sort of randomness brought all these things to work together so astonishingly and awesomely?! Billions of years isn't an answer, for no matter how long you keep writing alphabets randomly, you can't write a best selling novel even a primary school level story book!


Akin1212:
Artificial life is history. I knew you know nothing than to come here and make noise.

https://www.telegraph.co.uk/news/science/7745868/Scientist-Craig-Venter-creates-life-for-first-time-in-laboratory-sparking-debate-about-playing-god.html

You don't even understand how reactions work, talk more of the formation of nucleic acids. You think it takes place in one day? The formation of nucleic acids still take place inside humans and all living things including plants, but only this time it uses enzymes which make the reactions faster. I can't be teaching you biochemistry na, your ignorance is clearly written on the wall. Only if you approach your bold claims of your god existing this way lol. Science does not need to create a life for you to accept the truth, they only need to show processes with concrete evidence. Which have been shown already. But because you're still carrying about your childhood fears and fantasy, your mind is not open enough to accept the facts presented before you. However, how many concrete evidence have you provided for the existence of this your creator?
Wow, I don't understand how reactions work or the biosynthesis of nucleic acids?! Pray tell, how did you arrive at this conclusion?!

What Craig Venter did was to copy already existing DNA, synthesize it in the lab add watermarks and then incorporate it into an already existing cell! He even used the computer software as an analogy, so Mr. biochemist, if I took an OS say ubuntu, which is open source by the way, and make some changes like the welcome screen to show my name, that means I have created a computer?! As I have said earlier, synthesizing DNA in a testube does not mean you have 'created' life!

Your evidences thus far hasn't proven abiogenesis, you were told earlier that there is still a long way to go, even the researchers were humble enough to acknowledge their limitations, but you who is just reading online blogs is all over here bragging!

You said science doesn't need to 'create' life before I accept that it is the truth, but you are the one always demanding such incontrovertible proves and evidences before you accept anything as true, the evidences of the supposed processes you have provided thus far does not prove abiogenesis! So until you can provide the objective evidences to show abiogenesis, you are just believing it based on faith!

Let me help you understand your ignorant bragging here:

Akin 1212: "Artificial life is history." Provides evidence from a researcher called Craig Venter

What Craig Venter et al. did: "Then in 2010 they made the first self-replicating synthetic organism, manufacturing a version of M. mycoides’ genome and then transplanting it into a different Mycoplasma species. The synthetic genome took over the cell, replacing the native operating system with a human-made version. The synthetic M. mycoides genome was mostly identical to the natural version, save for a few genetic watermarks—researchers added their names and a few famous quotes, including a slightly garbled version of Richard Feynman’s assertion, “What I cannot create, I do not understand.”

With the right tools finally in hand, the researchers DESIGNED a set of genetic blueprints for their minimal cell and then tried to build them. Yet “not one design worked,” Venter said. He saw their repeated failures as a rebuke for their HUBRIS. Does modern science have sufficient knowledge of basic biological principles to build a cell? “The answer was a resounding NO,” he said." (Emphasis are mine)

For emphasis, “To my mind Craig has somewhat[b] overplayed the importance of this[/b],” said David Baltimore, a leading geneticist at Caltech. Dr. Baltimore described the result as “a technical tour de force” but not breakthrough science, but just a matter of scale…. “He has not created life, only mimicked it,” Dr. Baltimore said."

Indeed, artificial life is history according to our own nairaland 'distinguished' biochemist grin

Akin1212:
Lol, as usual. Allah said something and wrote it down in a book and sent it to one illiterate in a locality in Arabia Asia, isnt it? You like thinking you're intelligent, but even a 10 year old boy can quickly see how slow your mind is. You have obviously shot yourself in the foot.

While you yourself quoted that I supplied an experiment, synthetic DNA that are both my facts, all you had to show us is that in a trash book, Allah said something, therefore Allah exists. cheesy cheesy grin grin

Go and sit down in a closet and ask yourself countless times if you're making sense at all in the simplest ways possible, ask yourself o. cheesy
I had already presumed your response, you guys are easily predictable, and the level of my intelligence is way beyond your likes that read headlines to arrive at spurious conclusions! The real scientists are still very much uncertain about the origin of life, they are yet to prove the origin of life from non living materials, and show the process, but you my friend believe, afterall, according to you, "the truth about science is that it is true, whether anyone accept it or not" Just as any theist would say, the truth about my religion is that it is true, whether you accept it or not!
IslamRe: Atheism Is Foolishness? by sino(m):
I often wonder how convenient it is for these supposed atheists to question evidences about God, when they themselves hold on to some sort of faith in their acceptance of scientific hypotheses/theories…

Let me bring an example to drive home my point. Our ‘biochemist’ atheist (Akin1212) wants us to believe that abiogenesis is true, he has bragged about the achievements and breakthroughs thus far and how true they are, but quick to acknowledge the difficulty cum unlikelihood of ‘creating’ life from scratch…

So what evidences did Mr. Scientist bring thus far?!

1. Urey-Miller Experiment
2. Synthetic DNA

It should first be noted that the first has a lot of baggage, one of which is the assumption of the early earth and what it contained, also it still couldn’t account for the complex molecules found in life, not to even mention that the amino acids produced were racemic, and what happened to these amino acids to become 'alive', amongst others…Of course, there are more assumptions to explain away all these baggage

Secondly, synthetic DNA only shows that there is a need for an intelligent designer, it took the researchers more than 2 decades, of studying, planning, strategizing and experimenting to come up with a synthetic base pair not to also mention the fact that this synthetic base pair cannot do zilch except it is incorporated into already existing DNA and life! Wow! But about 3 billion base pairs found in man are from a random occurrence right?! Oh sorry, it took billions of years of purposeless trial and error to produce the complexity and diversity of life abi?!

When faced with the obvious reality which would require them to provide observable and reproducible concrete evidences of ‘creating’ artificial life from nonliving materials, the atheist could only but retort, demanding for evidences of how God created man! Well, out goes the scientific method guys….And in comes the faith-based science “the truth about science is that, it is true, whether you accept it or not”

Here above, we have the supposed evidences that our scientifically inclined ‘scientist’ atheist uses to believe in abiogenesis as true! When we then tell them that their own existence including the universe and how they function are evidences enough to prove the existence of an intelligent, powerful, all knowing etc. creator called God; they go on a hyperventilating tirade, as if that changes anything!

Allah (SWT) Says:

Or were they created by nothing, or were they the creators [of themselves]?
Or did they create the heavens and the earth? Rather, they are not certain.


(Qur'an 52:34-35)

Are the atheists here foolish?! Your guess is as good as mine! grin grin grin
IslamRe: Fabrications And Errors In Sahih Bukhari and Muslim by sino(m): 9:38am On Jan 31, 2019
najib632:
Al-baqir is spreading fitnah by Allah. Al-baqir it is better for you to stop these things, if only I knew Arabic I would have read the Arabic wording of those Hadith for myself. Thanks very much for this post @Empiree even though it was intended for @sino but it revealed @Al-baqir's intention of refusing the facts, even though he is the one that sent the write up himself. This has shown that Muslims really need to learn Arabic language if not criminals disguised as a scholars will mislead us.

As-salamualaikum.
You should take your time to read topics he had authored on this section, and see for yourself, the reason it is important to address some of his issues not necessarily for him to change his opinion, but for others who might not know better.

Thus far, just one hadith he had claimed to be fabricated he cannot prove beyond reasonable doubt, he has no scholar to back up his claims, but based on mere sentiments and how he feels about what the hadith means. If this was the way of our predecessors about the religion, we wouldn't even know what Islam is!

wa alaykum salam.
IslamRe: Fabrications And Errors In Sahih Bukhari and Muslim by sino(m): 9:29am On Jan 31, 2019
Empiree:
Lol, ise ke cheesy

Anyways, on behalf of albaqir (attachments)
@AlBaqir,

This was my post:

"Allah (SWT) Says:

“Whatever a Verse (revelation) do We abrogate or cause to be forgotten, We bring a better one or similar to it. Know you not that Allah is able to do all things?

Know you not that it is Allah to Whom belongs the dominion of the heavens and the earth? And besides Allah you have neither any Walee (protector or guardian) nor any helper.”

[al-Baqarah 2:106-107]

I guess this also means Allah (SWT), in your own words, forgets?! I just hope you really understand sincerely the implications of your deeds on here, whatever you think you want to gain here wouldn't help you in any way on the day you account for them!"

Instead of addressing my question, you went on with arguing about Naskh and Mansukh! It is you that wanted to turn this to an issue of abrogated verses must be in the Qur'an and what is meant by forgotten verses, not me, now you are crying foul! But this doesn't sway me at all, your deceitfulness is well established on this section.

I will help you understand my question properly, so you will not have a place to hide. Since you believe in Naskh and Mansukh, which means Allah (SWT) changed what He (SWT) had revealed earlier, does it mean Allah (SWT) forgot (in your own logic as applied to this narration in question) what He (SWT) ought to have revealed in the first instance?!

Answer the question!
IslamRe: Fabrications And Errors In Sahih Bukhari and Muslim by sino(m): 3:55pm On Jan 30, 2019
true2god:
In modern democracy he can do that. The Arabs of that period are backward and medivial in nature.
Okay noted! Thanks!
IslamRe: Fabrications And Errors In Sahih Bukhari and Muslim by sino(m): 3:27pm On Jan 30, 2019
true2god:
No, neither are you; we are all learners. You are twisting the context of the hadith to validate your claim and this is wrong. A revelation was given and was later modified after an objection was raised by a man.
Lol, yeah objection is the context of the narration, the blind man was already consulting his lawyers to sue! Talk about twisting to validate claims...
IslamRe: Fabrications And Errors In Sahih Bukhari and Muslim by sino(m): 3:01pm On Jan 30, 2019
^^^ This does not address my post in anyway, you are only trying to twist my post to suit what you think you can easily argue with. Unfortunately for you, you keep showing that my assertions about you are correct!

The question still remains, abrogated or caused to be forgotten (with all the possible opinions about what it means), Since you want to make this an issue of Naskh and Mansukh, does it mean that Allah (SWT) forgets (audhubullah min dhalik) as you claimed?!

When you are ready to answer the question, let me know.

@empiree, e ku ise o grin

1 2 3 4 5 6 7 8 9 10 (of 71 pages)